 New sesquiterpene synthases isolated from orange peel. (Machine-translation by Google Translate, not
专利摘要:
New sesquiterpene synthases isolated from orange peel. The present invention relates to a natural enzyme sesquiterpene synthase of orange tree (cstps3) with activity δ -cadinene synthase, as well as variants of said enzyme modified by the substitution of at least one amino acid that alters its catalytic activity, transforming them preferably into enzymes with elemol synthase or germacrene d synthase activity. The present invention also relates to the nucleic acid encoding the natural enzyme cstps3 as well as the modified versions derived from it, in addition to the gene constructions, expression vectors and bacterial strains comprising them. The invention also relates to the use of these enzymes to synthesize sesquiterpenes, preferably δ -cadinene, elemol and germacrene d, and provides a method for obtaining them. (Machine-translation by Google Translate, not legally binding) 公开号:ES2540791A1 申请号:ES201331820 申请日:2013-12-13 公开日:2015-07-13 发明作者:Omar José RUIZ RIVERO；Esther CARRERA BERGUA；María Jesús Rodrigo Esteve；Lorenzo Ángel ZACARÍAS GARCÍA；Manuel TALÓN CUBILLO 申请人:Consejo Superior de Investigaciones Cientificas CSIC；Instituto Valenciano de Investigaciones Agrarias IVIA； IPC主号:
专利说明:
NEW SESQUITERPENO SINTAS ~ S ISOLATED FROM ORANGE SKIN S Technical sector 10 1H 20 The present invention relates to a natural orange sesquiterpene synthase enzyme (CsTPS3) with B-cadineno synthase activity. In addition, the invention relates to a natural nucleic acid molecule isolated from the skin of orange fruits (Citrus sinensis) encoding the natural sesquiterpene synthase CsTPS3, with in vitro modified nucleic acid molecules derived from the natural sequence Cstps3, with their respective modified sesquiterpene synthase encoded enzymes, with methods for preparing sesquiterpene synthases, and with the bacterial cells that express the nucleic acids encoding the polypeptides of the invention. The present invention also relates to methods for synthesizing sesquiterpenes. For example, the sesquiterpene synthases object of the invention can be used to convert the precursor phamesyl pyrophosphate (FPP) into several bicyclic sesquiterpenes qw ~ include o-cadineno, l3-cubebeno, a-copaeno, germacreno D, a-cadineno and cubebol, and the monocyclic sesquiterpene elemol with a high mosquito repellent activity. Prior art 2S 30 Terpenoids (isoprenoids) are important natural products, of which more than 30,000 compounds have been identified in 131 plant kingdoms. Among them, monoterpenes (C10) and sesquiterpenes (C15) are the main constituents of essential oils of plant origin (Dewick, [2009] In Medició.1 Natural Products, John Wiley & Sons Ltd, Chichester-Wesl Sussex, pp 187 -310; Fra¡¡a, [2006] Nat Prod Rep. 23, 943-972). Sesquiterpenes are usually volatile compounds that can act as signal molecules for the attraction of pollinators and seed dispersers, herbivore predators or pest repellents, in addition to having an important role in communication between plants (reviewed by Gershenzon and Dudareva, [2007 ] Nat Chem Biol. 3, 408-414). 35 Terpene synthases (TPS) are the enzymes responsible for the formation of the great diversity of terpenes identified in the plant kingdom (reviewed by Chen et al., [2011] Plant J. 66, 212-219). Sesquiterpene syntheses convert the farnesyl pyrophosphate substrate (FPP) into various sesquiterpenes that can have different chemical structures. The Most of the plant TPS that have been biochemically characterized are multicatalytic and multi-product enzymes with high promiscuity and plasticity of amino acids. Apparently, several amino acids located at the active site and surrounding layers of multifunctional TPS act collectively to control the cascade in reaction that leads to the formation of complex mixtures of sesquiterpenes (Miller and Allemann, [2012] Nat Prod Rep. 29, 60 -71). Although there have been many monoterpenes and sesquiterpenes that have been identified in several species of the Citrus genus (reviewed by ladeo et al., [2008] Ad Bot Res 47, 147223), few have been the monoterpene and sesquiterpene synthase genes and enzymes that have been They have isolated and characterized biochemically. With respect to sesquiterpene synthases, the orange Cstps1 gene (Citrus sinensis) which encodes a Valencian synthase (CVS) (Sharon-Asa et al., (2003) Plan / J. 36, 664-676), was patented by the Ministry of Agriculture of Israel (WO 2005/021705, March 10, 2005). To date, other vegetable monoterpene and sesquiterpene synthase have been patented such as: Ea.bisabolene synthase, & -selinine synthase and y-humulene synthase of the giant fir Abies grandis (US 6451576, Washington State University Research Foundation, September 17, 2002); y-curcumene synthase, (+) - germacrene A synthase, (-) - germacrene D synthases and pachoulol synthases of patchouli (Pogos / emon cablin) (WO 2005/052163, Firmenich SA, June 9, 2005); Multifunctional sesquiterpene synthases from Vetiveria zizanoides, which catalyze the formation of cyclocopacanphene, (+) - epi-¡3-santaleno, trans-a-bergamoteno, cis-abergamoteno, p-bisaboleno and / or / rans-l "bisabolene (WO 2006 / 134523, Firmenich SA, December 21, 2006); multifunctional germacrene O synthase of the kiwi fruit (W02004 / 058814, The Horticulture and Food Research Institute 01 New Zea / and Limi / ed, July 15, 2004); santaleno sin Rate (SSy) of the species Santalum album (SaSSy), S. aus / rocaledonicum (SauSSy) and S. spica / um (SspiSSy) (WO 2011/000026, June 6, 2011, The University of Western Australia, Forest Products Commission, University of British Columbia, and Joerg Bohlmann); and modified Valencian synthases (WO 2012/058636, Allylix INe, May 3, 2012). The commercialization of vegetable terpenes worldwide reaches 20 billion dollars annually. The growing demand for terpenes of plant origin by the cosmetic and perfume industry has forced the search for new sources and the subsequent acceptance of synthetic equivalents with less odor and quality. The chemical synthesis of terpenes (using heavy substances), results in highly complex mixtures (collateral products and isomers), which subsequently require laborious and expensive purification stages To date there is no method of chemical synthesis of terpenes that is respectful of the environment and is also notoriously efficient. On the contrary, there are several examples that samples such as biotechnology can be an economic and reliable strategy against chemical synthesis or conventional distillation from raw materials of plant origin (reviewed by Krings and Berger, [2010] Nat Prod Commun. 5, 1507-1522). Recombinant DNA technology and molecular biology tools, the availability of nucleic acid and protein databases, as well as the design of computer programs for in situ / modeling and molecular protein coupling, have contributed to the rapid progress of the Terpene biosynthesis In addition to their biological importance as chemical signals, terpenes of plant origin have immense commercial value due to their use as fragrances in cosmetics and perfumery, as organoleptic food and beverage additives or to add desirable fragrances to cleaning products. The use of essential phyto-oils, as well as their components in isolation (mainly monoterpenes and sesquiterpenes), as repellents of mosquitoes that transmit certain high-risk infectious tropical diseases, such as: malaria, dengue hemorrhagic fever, yellow fever, filariasis or fever West Nile (West Ni / e Virus Infection: WNV), also gives them great medical and pharmaceutical interest (reviewed by Pohlit et al., [2011] Planta Medica 77, 598-617). In September 2012, the northern domestic mosquito (Culex pipens) caused 2,636 cases of WNV infection in the eastern United States of America, producing 118 deaths. Of the total cases detected, 53% showed neuroinvasive complications (meningitis and encephalitis) (http://www.cdc.gov/ncidod/dvbid/westnile/index.htm). Essential phytoaceites extracted from citronella (Cymbopogon spp.), Eucalyptus (Eucalyotus L'Hér. Spp), and basil (Ocimum spp), have traditionally been used as mosquito repellents in the manufacture of candles, lotions, gels, sprinklers and towels hygienic Do not impede, the effectiveness of these products as insect repellents is questionable. Recently, 70 essential phytoaceites used in different patents of mosquito repellent formulas have undergone extensive reviews (Nerio et al., [2010] Bioresour Techonol. 101, 372-378: Pohlít et al., (2011) Planta Medica 77, 618-630). In contrast to insect repellents of plant origin, the active synthetic ingredient present in most pharmaceutical formulas that are marketed as hematophagous mosquito repellents, is DEET (N, N-diethyl-m-toluamide). However, its use has certain drawbacks, since it has an unpleasant smell and its cutaneous application can be irritating, in addition to conferring certain harmful effects on health, especially in children. In this sense, repellents and insecticides of plant origin are considered as a promising alternative to synthetic repellents, due to their low toxicity and environmental safety (Katz et al., [2008] J Am Acad Dermatol. 58, 865871). Consumers, increasingly aware of issues related to public health and environmental safety, demand insect repellent formulas that do not pose a danger to their health or the environment. That is why the pharmaceutical industries continue to work in the search for insect repellent formulas harmless to public health, and to improve existing ones by incorporating vegetable terpenes with a high capacity and wide spectrum of repellent action. Sesquiterpene-rich phytoaceites, as well as their purified components, which contain alcohol, aldehyde, ketone or acid radicals, have a greater scientific interest due to their greater efficacy as alternative natural repellents, than those that contain DEET. Thus, for example, elemol and 3-eudesmol in addition to being effective as larvicides also exhibit high repellency against female adult mosquitoes (Coats et al. (2003) US Patent No. 6,524,605; (2005) US Patent No. 6,524,043; Sehullz et al., (2004) Environ Entomol. 33, 1562-1569; Palaueh et al. (2009) J Agri Food Chem. 57, 7618-7625; Zhu et al., (2008) J Am Mosq Control Assoe. 24,161-168). Recently, elemol has been shown to be a potent repellent of nymphs of the black-legged tick (Ixodes scapularis), and the lone star tick (Amblyomma americanum), transmitters of Lyme disease and human monocytotropic Ehrlichiosis, respectively ( Carrol et al., [2010] Exp Appl Acarol. 51, 383-392). In vitro and in vivo tests have shown that relatively low concentrations of the mole are sufficient to repel ticks and mosquitoes (adult females and larvae). In addition, the fact that elemol is as effective or more than DEET (the standard repellent used to compare the effectiveness of other repellents) strongly supports its use as an effective repellent for use in commercial formulas. In this regard, there is a record of an international patent (WO 2007/109736, lowa State University Research Foundation, 2yth September 2007), related to the design of mixtures of essential phytoaceites containing ele mol, or phytoaceites and elemol, or mixed elemol with stabilizers, to be used as repellents of the northern mosquito (Culex pipens), vector of yellow fever (A. aegyptl), and of the common cockroach (Blattella germanica). At present, the elemol that is used for commercial purposes is distilled from citronella oil (C. winterianus) (http://gbffchina.en.alibaba.com/), and its world trade is 1 -10 metric tons per year (reviewed by Bahtia and colo, (2008] Food & Chemica / Toxico /. 46, 8147-8148.). An objective of the present invention is to provide new sesquiterpenes without fees (TPS) capable of catalyzing the transformation of FPP into cyclic sesquiterpenes based on the chemical structure of germacrene or elemene. It is also an objective of this invention, to provide modified TPS capable of synthesizing sesquiterpenes for which no citrus enzyme has been isolated. In particular, it is the object of the present invention to provide a way of synthesizing the oxygenated monocyclic sesquiterpene elemol, which has a potent mosquito repellent activity, through the expression of modified vitreous TPS derived from the natural T-O-cadineno synthase TPS isolated from the skin of orange fruits, object of this invention. Brief Description of the Invention The vast majority of sesquiterpenes used in cosmetics and perfumery are extracted from plants in the form of essential oils (phytoaceites). The price and availability of phytoaceites depends largely on the geographical distribution of the plant species used as raw material for their extraction, as well as their abundance and yield. Due to the complexity of its structure, the chemical synthesis of terpenes is limited by its laborious processes and high production costs. The low abundance of terpenes without plant fees and the high difficulty of purifying them from mixtures of resins and phenolic compounds makes it almost impossible to isolate these enzymes from the tissues that express the genes that encode them. The constant increase in knowledge of terpene biosynthesis pathways, as well as the biochemical characterization of the activity of its biosynthetic enzymes, has opened up new perspectives for the biotechnological production of terpenes and guarantee the sustainability of the sector. The design of biochemical processes for the production of terpenes is, therefore, of great interest, but requires isolation and manipulation by means of genetic engineering techniques of the nucleotide sequences that encode terpene synthases. Specifically, the present invention contemplates: (1) natural nucleic acid molecules isolated from the skin of oranges encoding a sesquiterpene at no rate that catalyzes the synthesis of cyclic sesquiterpenes, (iI) recombinant sesquiterpene synthases, (iil) recombinant expression vectors in which the polynucleotide sequences encoding the sesquiterpene synthases object of the invention have been cloned, (iv) cells bacteria that have been transformed with the recombinant vectors object of the invention, and (v) methods for the in vitro production of cyclic sesquiterpenes, including the steps of introducing the recombinant vectors into bacterial cells, under conditions that ensure the expression of the Nucleotide sequences object of the invention, as well as induction of the synthesis of encoded proteins in transformed bacterial cells. The present invention also describes the methods used for the modification of the natural orange sesquiterpene synthase object of this invention, as well as the modified versions derived therefrom. Representative DNA molecules of that natural TPS isolated from the flavedo (skin) of oranges object of the present invention, were cloned and sequenced, their amino acid sequence was deduced and their enzymatic activity was tested in vitro. Specifically, the natural nucleotide sequence isolated from orange fruit flavedo (Citrus s; nensis) encodes the enzyme & -cadinene synthase SEQ ID NO: 2 (CsTPS3). In addition to the natural enzyme & -cadinene synthase of orange tree object of the present invention, it is also described to obtain modified versions derived from it, which are contemplated within the protection of the invention, except to the extent that they were limited by state of the art The modified enzymes object of this invention have an altered specificity and rationalization of products. Examples of these are those modified enzymes that produce higher relative levels of germacrene O and small amounts of ~ -elemene and a-gurjuneno, or those that produce higher levels of elemol compared to the corresponding levels produced by the natural version CsTPS3. It should be noted that elemol is a potent repellent of mosquitoes that transmit diseases that are considered high risk for public health, as well as being a fragrant ingredient widely used in cosmetics and perfumery. In other aspects, this patent provides the bacterial cells that were transformed with the recombinant expression vectors in which the DNA sequences object of the invention were cloned. In this sense, and specifically the recombinant plasmids expressing the orange sesquiterpene synthase & -cadinene synthase (CsTPS3) of orange tree are provided, as well as the modified versions derived from it, in which amino acid changes have been introduced that alter their catalytic activity and / or product specificity. Therefore, microorganisms (bacterial cells) or transgenic plants that express the nucleotide sequences encoding the sesquiterpene synthases object of the present invention, can be used as biofactories for the production, isolation and purification of significant amounts of the natural enzymes o-cadineno without rate (CsTPS3) and its modified versions, as well as the sesquiterpenes product of its catalytic activity. Description of the figures Figure 1. DNA sequence of the Cstps3 gene (SEO ID NO: 1), and of the mutant versions derived from it, and deduced amino acid sequence of the encoded polypeptides. (TO) DNA sequence of the Cstps3 gene (SEO ID NO: 1), and of the encoded polypeptide (CsTPS3, SEO ID NO: 2). (B) DNA sequence of the Cstps3-VB2 version (SEO ID NO: 3), of the encoded polypeptide (CsTPS3-VB2, SEO ID NOA). (e) DNA sequence of the Cstps3-VB5 version (SEO ID NO: 5), and of the encoded polypeptide (CsTPS3-VB5, SEO ID NO: 6). (D) DNA sequence of the Cstps3-VCl version (SEO ID NO : ), and of the encoded polypeptide (CsTPS3-VC2, SEO ID NO: 8). (E) DNA sequence of the Cstps3-VC2 version (SEO ID NO: 9), and of the encoded polypeptide (CsTPS3-VC2, SEO ID NO: 10). Figure 2. Chemical structure of volatile sesquiterpenes emitted by the Ilavedo de NaveL oranges Some of them correspond to sesquiterpenes identified as products of the catalytic activity of natural sesquiterpene synthase CsTPS3 and its modified versions, objects of the invention. Figure 3. Multiple alignment of the deduced amino acid sequence of the CsTPS3 polypeptides (SEO ID NO: 2), and mutant versions VB2 (SEO ID NO: 4), VB5 (SEO ID NO: 6), VC1 (SEO ID NO: 8), and VC2 (SEO ID NO: 10 ). The sequence deduced from CSTPS3 polypeptide amino acids are shown at the top of the alignment. The substituted amino acids in each of the mutant versions are indicated. The dots represent identical amino acids between the variant polypeptides and the natural sequence CsTPS3. Figure 4. Multiple alignment of truncated ESTs that share similarity with the Cstps3 nucleotide sequence encoding the orange sesquiterpene synthase CsTPS3 (C. sinensis varo Washington Navel) object of the invention. The oligonucleotides used as primers in PCR assays for amplification of the complete coding sequence of the Cstps3 gene are indicated. The white letters on a black background represent identical nucleotides in the same position. The letters on gray background they represent different nucleotides in the same position. The dashes represent gaps in the nucleotide sequence. Figure 5. Multiple alignment of the deduced amino acid sequence of the natural polypeptide CsTPS3 (SEO ID NO: 2) and other phylogenetically related plant germacrene synthases (Ger). The alignment was carried out with the Expresso 3D Coffee software (http://www.tcoffee.org/), using as a model the crystallographic structure of the tobacco 5-epi-Aristoloquene synthase (TEAS. PDB: 5EAT [DOI: 10.2210 / pdb5eatlpdb]). Absolutely conserved amino acids are shown on a black background, while highly conserved residues are shown on a gray background (pale or dark). The preserved RRX8W, RXR, GVYFEP, DDX2D, NSE / DTE motifs of vegetable sesquiterpenes synthases are indicated on the alignment. AdGerD (Actinidia deliciosa GerD, AAAX16121), CcGerB (Cis / us creticus GerB, ACF94469), Nt5EAS (Nicoliana tabacum TEAS, 040577); PldGerD (Populus trichocarpa x deltoides GerD, AAR99061), RhGerD (Rosa hybrida GerD, B0105086), and VvGerD (Vilis vinifera GerD, AAS66357). (.ó.) Indicates amino acids involved in the catalysis of TEAS. The residues indicated with (...) were mutagenized to know their role in the catalytic activity of the CsTPS3 enzyme. (§) It indicates amino acids that, in the same position, are different in the CsTPS3 polypeptide compared to the rest of the TPS activity polypeptides used in the alignment. Figure 6. Phylogenetic tree of vegetable sesquiterpene synthases of the TPS-a subfamily, including the CsTPS3 polypeptide. The tree was constructed by maximum likelihood analysis, using the amino acid sequence of enzymes with activity cubebeno (Cub), cadineno (Cad) and germacreno (Ger) synthase. AaGerA (Artemisia annua GerA, AAX16121), AdGerD (Actinidia deliciosa GerD, AAAX16121), CcGerB (Cistus creticus GerB, ACF94469), CiGerA (Cichorium intybus GerA, AAM21658, CmGerD (Cucumis mela GerD, ABX83200), CsTPS3 (Citrus sinensis TPS3), Ga (G) + - & - Cad, CAA77191), Gh (+) - o-Cad (Gossypium hirsitum (+) - & - Cadineno, AAX44033), HaCad (Helianthus annuus Cad, AAY41422), IdGerA (Ixeris dentate GerA, AAL92481), LhGerB (Lycopersicum hirsitum GerB, AAG41891), LhGerD (L hirsitum GerD, AAG41892), LsGerA (Lactuca saliva GerA, AAM 11 627), Mg- ~ -Cub (Magnolia grandiflora ~ -Cub, ACC66281), MtTPS5 (Medicago truncatula TPS5, ABB01625), Ob (+) - GerD (Ocimum basilicum (+) - GerD, AAV63786), PcGerA (Pogostemon cablin GerA, AAS86321), Pc (-) - GerD (P. cablin (-) - GerD, AAS86320), Pt (-) - GerD (Populus trichorcapa x deltoids (-) - GerD, AAR99061), RhGerD (Rosa hybrida GerD, B0105086), SaGerD (Santalum album GerD, ACF24768), ScGerA (Solidago Canadnsis GerA, CAC36896), Sc (+) - GerD (S. Canadnsis (+) - GerD, AAR3114), Sc (-) - GerD (S. Canadnsis GerD, AAR3115 ), SIGerC (Solanum Iycopersicon GerC, AAC39431), Vv (-) - GerD (Vilis vinifera (-) - GerD, AAS66357), and Zo (+) - GerD (Zingiber officinale (+) - GerD, AAX40665). Figure 7. Profile of volatile sesquiterpenes produced by the CsTPS3 protein, and each of its mutant versions, under the conditions of the enzyme assay l. Sesquiterpenes were identified by gas chromatography analysis coupled to mass spectrophotometry. The volatile sesquiterpenes identified in enzymatic assays in which the FPP substrate was exposed to: (A) the CsTPS3 polypeptide (SEO ID NO: 2): (B) the modified CsTPS3-VB2 polypeptide (SEO ID NO: 4) are shown: (C) CsTPS3-VB5 modified polypeptide (SEO ID NO: 6): (D) CsTPS3-VC1 modified polypeptide (SEO ID NO: 8): (E) CsTPS3-VC2 modified polypeptide (SEO ID NO: 10) . The number on each peak of the gas chromatogram indicates the volatile sesquiterpene identified by mass spectrophotometry. (F) Mass spectrum of each of the sesquipepenes identified. The mass spectrum, common name and calculated retention rate are shown for each picket. The mass spectrum of each of the standards of the volatile sesquiterpene library used is also shown for comparative and authenticity of the sesquiterpene identified. Figure 8. Profile of volatile sesquiterpenes produced by the CsTPS3 protein, and each of its mutant versions, under the conditions of the enzymatic assay 11. Sesquiterpenes were identified by gas chromatography analysis coupled to mass spectrophotometry. The volatile sesquiterpenes identified in enzymatic assays in which the FPP substrate was exposed to: (A) the CsTPS3 pOpeptide (SEO ID NO: 2) are shown: (B) the modified CsTPS3-VB2 polypeptide (SEO ID NOA): (C ) CsTPS3-VB5 modified polypeptide (SEO ID NO: 6): (D) CsTPS3-VC1 modified polypeptide (SEO ID NO: 8): (E) CsTPS3-VC2 modified polypeptide (SEO ID NO: 10). The number on each peak of the gas chromatogram indicates the volatile sesquiterpene identified by mass spectrophotometry. (F) Mass spectrum of each of the sesquiterpenes identified. For each peak, the mass spectrum, the common name and the calculated retention rate are shown. The mass spectrum of each of the standards of the volatile sesquiterpene library used is also shown for comparative and authenticity of the sesquiterpene identified. Figure 9. FPP cyclization mechanisms proposed to explain the specificity of cyclic sesquiterpenes produced by the enzymatic activity of the CsTPS3 polypeptide (SEO ID NO: 2). Each cycle route involves the transformation of Z, E-germacradienil cation (A) or E, E-germacradienil cation (B). The name of the macrocyclic cationic intermediaries proposed for each cycle route is shown. Possible routes that lead to the formation of multiple products are indicated by lowercase letters in bold and in brackets. The final products of each route are highlighted in bold. (ll) Heating at the injection port. The chemical structures were drawn with the ChemSioDraw Ultra 11.0.1 software (CambridgeSoft). Figure 10. Three-dimensional (3D) structure of the CsTPS3 polypeptide. The simulation of the structure of the CsTPS3 protein was performed using as a standard the 3D structure of the tobacco 5-epi-aristoloquene synthase obtained by X-ray crystallography (TEAS, PDS code: 5EAT) (Starks et al., [1997) Science 277, 1815-1820). The boxes show a detail of the active site CsTPS3 protein. The side chains of the amino acids that form the catalytic cavity, and the neighboring bonds are represented with lines. Likewise, the position of the amino acids involved in catalysis is indicated. The 3D structure of the CsTPS3 polypeptide is imposed on that of TEAS forming a complex with the farnesyl hydroxyphosphate analog substrate (FHP). The images were obtained using in si / ieo modeling using the Discovery Studio v3.5 software (Accelrys Software Inc.). Figure 11. Detail of the 3D structure of the catalytic cavity at the active site of the CsTPS3 polypeptide, in comparison with the corresponding active site of the 5-epiaristolokene synthase protein (TEAS, PDS code: 5EAT). The imposition of the CsTPS3 polypeptide on the 3D structure of the TEAS shows the differences in identity and spatial location of the side chains of the amino acids within the cavity of the active site. The 3D structure of TEAS is shown forming a complex with the farnesyl hydroxyphosphate analog substrate (FHP). Dates indicate amino acid residues that differ in identity or spatial location. The images were obtained using in si / ieo modeling using the Discovery Studio v3.5 software (Accelrys Software Inc.). Figure 12. Detail of the structure of the catalytic cavity at the active site of the modified polypeptides CsTPS3-VS2 (SEO ID NO: 4) and CsTPS3-VC1 (SEO ID NO: 8), compared to the corresponding active site of the 5-epi-aristoloquene synthase protein (TEAS, PDS code: 5EAT). The imposition of CsTPS3-VS2 (A) or CsTPS3 polypeptides VC1 (B) on the 3D structure of TEAS shows the differences in identity and spatial location of the side chains of the amino acids replaced within the cavity of the active site. The side chains of the amino acids that form the catalytic cavity, and the neighboring bonds are represented with lines. The amino acids selected for the directed mutagenesis of the CsTPS3 polypeptide are represented in light gray, while the substituted residues in the modified polypeptides are indicated by arrows. The structure of the modified polypeptides is shown overlapping with TEAS (although not shown in the image) forming complex with the farnesyl hydroxyphosphate analog substrate (FHP). The images were obtained by in situ modeling using the Discovery Studio v3.5 software (Accelrys Software Inc.). Detailed description Specific aspects of the present invention, such as the technical terms used, the techniques used, the experiments carried out and the results obtained, are described in detail below. Also, in the text reference is made to the attached figures, which in turn are part of the invention, and are intended to illustrate the concepts discussed and / or results obtained. It is understood that although modifications or structural changes are made in some aspects of the invention, this does not imply the loss of novelty or protection of the invention. Therefore, the detailed description of the invention, and the range of protection of the present patent should not be considered in a limited sense. The range of protection of the present patent is subjugated to the appended claims, fully protecting each and every one of the equivalents to which such claims entitle. First, the scientific and technical terms used in this patent are defined. Next, the natural nucleotide sequence corresponding to the coding region of the Cstps3 gene isolated from the orange fruit flavedo, as well as the encoded polypeptide (CsTPS3), is described. Subsequently, the in vi / ro modified nucleotide sequences derived from the natural Cstps3 sequence are described, as well as the corresponding encoded variant polypeptides. Finally, the materials and methods and results obtained are also described in detail, as specific examples of the present invention. Definition of terms A "terpene" is a hydrocarbon molecule with a basic chemical structure of five carbon atoms called isoprene (CsHa), which can be closed (cyclic) or open (acyclic). Terpenes include among others o-cadineno, a-copaeno, ¡3-cubebeno, germacreno D, a-gurjuneno, ¡3-elemeno and elemol. In this sense, the terms "terpenes" and 5 "terpenoids" are used herein to refer to terpenes and derived terpenes, including those that have undergone one or more stages of modification (hydroxylation, isomerization, oxide-reductions, methylation or acylation). As used herein, the term "sesquiterpene" refers to a terpene formed by five isoprene units (C1S), including those that have undergone one or several stages of modification and / or functionalization. As used herein, the term "sesquiterpene synthase" refers to an enzyme that tastes, in the presence of magnesium and molecular oxygen, the transformation of the acyclic farnesyl pyrophosphate (FPP) precursor into one or more cyclic or acyclic sesquiterpenes. In this sense, if a multifunctional sesquiterpene synthase (one that is capable of producing more than 15 of a sesquiterpene), produces 3-copane as the main product, the enzyme is consequently called the 3-copane synthase. According to the invention, the main product or major sesquiterpene can be obtained depending on the conditions used with a relative abundance of between 25% and 100%, preferably between 25% and 90%, more preferably between 45 % and 90%, even more preferably between 20 and 65%, and even more preferably between 75% and 90%, with respect to the total amount of sesquiterpenes produced. Similarly, when sesquiterpene synthase produces more than one sesquiterpene, minor sesquiterpene or sesquiterpenes are obtained with a relative abundance of less than 25%, preferably between 1% and 25%, more preferably between 2.5%. and 25%, more preferably from among 25 4% AND 23%, even more preferably between 8% and 23%, and still more preferably between 11% and 20%, with respect to the total amount of sesquiterpenes produced. The term "nucleic acid" or "nucleic acid molecule" refers to polymers of 30 deoxyribonucleotides (nucleotides) in the form of a double stranded molecule (DNA: Qeoxyrribo.Q.ucleic ªcid). As used herein, the term "nucleotide" refers to the monomeric unit of DNA, which is formed by a sugar molecule of five carbon atoms (pentose), a phosphate group and a nitrogen base (adenine [A], guanine [G], cytosine [C] and thymine [T]). The order of nucleotides in the main strand of DNA 35 determines the order of amino acids along the polypeptide chain or protein. Therefore, the DNA sequence encodes the amino acid sequence of a protein. As used herein, the term "coding DNA sequence" (CDS: Coding DNA ~ equence), refers to the portion of a gene (including only exons) that encodes an integral protein (fulllength). The integral CDS of any gene comprises the nucleotide sequence between the start codon (ATG), at its 5 'end, and the codon of 5 stop (TAG, TAA or TGA), at the 3 'end. As used herein, the term "amino acid" refers to natural molecules (H2NCHRCOOH) that contain an amide (-NH2) and a carboxylic (-COOH) group, in addition to a side chain (R) that is specific to each amino acid . The Twenty (20) 10 natural amino acids combined in the form of polypeptide chains, form the basic units of the set of proteins (proteome) of an organism. Amino acids are identified by an international nomenclature established by the IUPAC (lntemational! J.nion ofEure and & Jplied Chemistry), as they appear in Table 1. TABLE 1 Code Code Amino acid one letter three letters Alanine Cysteine Aspartic acid Glutamic Acid Phenylalanine Glycine Histidine Isoleucine Lysine Leucine A C D E F G H K L ToCysAspGluPheGlyHisIleLysLeu Code Code Amino acid one letter three letters Methionine Asparagine Proline Glutamine Arginine Serine Threonine Valine Tyrosine Tryptophan M Met N Asn P Pro Q Gln R Arg S Be T Thr V Val Y Tyr W Trp As used herein, the term "oligonucleotides" refers to short sequences or 15 single-chain polydeoxyribonucleotides, which are used as primers for amplification of specific DNA fragments by PCR assays (Eolymerase ~ hain Reaction), widely known in the state of the art. The oligonucleotides are chemically synthesized, and purified by different methods, which include the use of reverse phase cartridges, HPLC (!: 1igh E, erformance L / quid Chromatography), or 20 polyacrylamide gels. As used herein, the term "percent identity" refers to the percentage of amino acids that in a comparison of two or more proteins occupy the same relative position along the alignment. The term similarity percentage used here is a statistical measure of the degree of kinship of two or more protein sequences, based on the chemical properties of each group of amino acids compared throughout the sequences. Both parameters, the percentage of identity and similarity, are calculated by computer programs that assign a numerical value to each group of amino acids compared along the sequence of aligned proteins. The similarity leaves room for conservative variation, this is the substitution of a hydrophobic residue 10 such as isoleucine, valine, leucine or methionine amino acids for another, or the substitution of one polar residue for another, such as arginine for lysine, glutamic acid for aspartic acid, or astaragine glutamine. The intended substitution of an amino acid can be made based on similarity in polarity, charge, solubility, hydrophobicity and / or the amphipathic nature of the residues provided that the biological activity of the polypeptide is preserved. In a preferred embodiment, the homology percentages indicated herein refer to sequence identity percentages. For example, the amino acid sequence identity in percent (%) with respect to a particular reference sequence may be the percentage of amino acid residues in a candidate sequence that are identical to the amino acid residues in the reference sequence. If necessary, 20 gaps can be introduced in the aligned sequences to achieve the maximum percentage of sequence identity, without being considered conservative substitutions of sequence identity. The term "modified nucleic acid molecule" as used herein refers to a 25 DNA molecules that have differences in their sequence of deoxyribonucleotides (deletions, insertions, transitions and transitions) with respect to the natural or wild molecule (wild type). Consequently, such changes or "mutations" are transmitted to the proteins encoded in the form of substituted, deleted or added amino acids (insertions). The mutation may have no effect on the enzymatic activity of the 30 mutated protein, or on the contrary can increase, reduce or annihilate it completely. In other cases, the replaced amino acid corresponds to a conservative or non-conservative substitution. For example, changing a hydrophobic amino acid to a hydrophilic (charged or polar) amino acid at the active site of a protein or in surrounding layers could affect the activity of the protein. Such modifications may introduce into an acid molecule. 35 nuclei by known techniques with the name of site-directed mutagenesis. To this end, there are several commercial kits based on PCR techniques, such as Stratagen single or multiple directed mutagenesis systems. These systems allow the generation of single or multiple mutations simultaneously in a given nucleotide sequence, which has been previously cloned into a plasmid or expression vector, without the need for subsequent subcloning or the generation of single-chain phagemids. Both methods require the use of specific oligonucleotides that contain the desired mutation and several nucleotides on each side that perfectly match the target sequence. In this way the oligonucleotide that carries the mutation, and which functions as a primer, can hybridize with the target DNA sequence that is used as a template for synthesis by a PCR reaction of DNA sequences that will carry the desired mutation in The selected position. The term "expression vector" as used herein refers to a plasmid (circular double-stranded DNA molecule capable of replicating autonomously and independently of the genomic DNA of the host bacterial strain), which contains regulatory elements ( promoters, operators and / or enhancers) that control the expression of a foreign DNA sequence encoding the polypeptide of interest. Since expression vectors are generally relatively small plasmids that can be up to hundreds of copies per bacterial cell (multicopy plasmids), induction of foreign DNA sequence expression ensures rapid accumulation of high levels of transcripts (molecules of messenger RNA) and hence of the encoded protein. As used herein, the term "transformed cell", "transformed" and "transformation" refers to the introduction by different methods (chemical or electroporation) well known in the state of the art, of recombinant plasmids or plasmids into a cell here called "host cell". This can be a prokaryotic cell such as the different strains of the Eseheriehia eoli bacteria (TOP10, Novablue, BL21 [DE3) pLysS, etc.). Detailed description of the invention The present invention describes a natural nucleotide sequence corresponding to the coding sequence of a gene here isolated from the flavedo (skin) of orange fruits (Citrus sinensis) of the Navel variety. This sequence encodes a multiproduct TPS that catalyzes the synthesis of several cyclic sesquiterpenes. Representative cDNA molecules of said gene were sequenced and the amino acid sequence of the encoded polypeptide was deduced. In this sense, the present invention relates in the first instance to: (a) A polynucleotide sequence corresponding to an orange tree gene, hereinafter referred to as Cstps3, comprising the sequence shown in Fig. 1A (SEO ID NO: 1), which encodes a polypeptide, hereinafter CsTPS3, with a activity majority o-cadineno synthase, which has the deduced amino acid sequence shown in Fig. 1 B (SEO ID NO: 2). In the present invention, in vitro mutated nucleic acid molecules (variants), which encode modified polypeptides containing at least one change are also described. of amino acid with respect to the natural polypeptide sequence of the CsTPS3 protein (SEO ID NO: 2) (Table 2). In this regard, the present invention provides modified nucleic acid molecules that contain: (b) Changes in the nucleotide sequence of the identified natural DNA molecule as SEO ID NO: 1 (Cstps3), which translate into changes in the amino acid sequence of the encoded polypeptide. Examples of such modified DNA molecules are those identified as SEO ID NO: 3 (Fig. 1 B), SEO ID NO: 5 (Fig. 1C). SEO ID NO : (Fig. 10). AND SEO ID NO: 9 (Fig. 1 E). The invention further provides modified sesquiterpene synthases containing amino acid changes with respect to the natural polypeptide sequence of the CsTPS3 polypeptide. Among the modified polypeptides are those containing: (c) Simple or multiple changes (substitutions) of amino acids with respect to the natural polypeptide sequence of the CsTPS3 polypeptide identified with the SEO ID NO: 2 reference. In a more specific sense, the modified sesquiterpene synthases encoded by the in vitro mutated nucleic acid molecules provided herein are those modified polypeptides that: (d) Contains replacement C455G (hereinafter VB2 version, identified as SEO ID NO: 4), or a combination of substitutions S418H and C455G (S4 18H / C455G) (version VB5, identified as SEO ID NO: 6) , or a combination of amino acid replacements S 416T / G4 17T / S4 18y (hereinafter VC1 version, identified as SEO ID NO: 8), or a combination of amino acid replacements S41¡; T / G417T / S418Y / S422A (hereinafter VC2, identified as SEO ID NO: 10), numbered according to the relative positions of SEO ID NO: 2. For example for the modified version CsTPS3-VB2 the nucleic acid molecule provided here encodes a modified CsTPS3 containing the C455 amino acid replacement that is C455G (Fig. 3). TABLE 2 List of single and multiple replacements introduced in the natural CsTPS3 polypeptide (SEO ID NO: 2), as a consequence of base pair substitutions (transitions and / or transitions) introduced into the nucleotide sequence of the integral coding region of the Cstps3 gene ( SEO ID NO: 1) SEQ ID NOT mutated Version Mutations introduced in CsTPS3 mutant cONA Polypeptide 82 C455G34 85 S41 6H / C455G56 VC1 S41 6T / G417T / S41 8y78 VC2 S41 6T / G417T / S418Y / S422A910 The modified sesquiterpene synthases provided herein have an altered catalytic activity. The effect of amino acid changes introduced in the polypeptide sequence 5 of the modified proteins was such that it altered the specificity and / or distribution / rationalization of the products (i.e. alteration of the quantities and / or types of sesquiterpenes produced), compared to the activity of the natural sesquiterpene synthase CsTPS3 identified as SEO ID NO: 2. Therefore, a first aspect of the invention relates to a polypeptide, herein referred to as a polypeptide of the invention, which has sesquiterpene synthase activity and comprises a sequence with at least 90% identity, preferably with at least one 95%, and more preferably with at least 98%, and even more preferably with at least 99% identity, to SEO ID NO: 14. Such activity 15 sesquiterpene synthase of the SEO ID polypeptide No: 14 is preferably at least one selected from the group consisting of: o-cadineno synthase activity, elemol synthase activity and germacrene D synthase activity. SEO ID NO: 14 consists of a polypeptide sequence in which: 20 the amino acid at position 416 is independently selected from Thr or Ser; the amino acid at position 417 is independently selected from Thr or Gly; the amino acid at position 418 is independently selected from Ser, Hys or Tyr, and preferably is Ser or Tyr; the amino acid at position 422 is independently selected from Ser or Ala, and preferably it is Ser; Y 5 the amino acid at position 455 is independently selected from Cys or Gly; and comprises the sequence of the CsTPS3 protein isolated from orange or one of its mutants with sesquiterpene synthase activity. In particular, said orange tree CsTPS3 protein has a majority activity 10 or-cadineno synthase, and consists of the sequence SEO ID NO: 2, which corresponds to the sequence SEO ID NO: 14 where: the amino acid in position 416 is Ser, the amino acid in position 417 is Gly, the amino acid in position 418 is Ser, the amino acid at position 422 is Ser, and the amino acid at position 455 is Cys. However, being considered an ocadineno synthase and which is capable of producing preferably between 25% and 50% O In certain conditions, with respect to the total amount of sesquiterpenes produced by said synthase, the CsTPS3 polypeptide (SEO ID NO: 2) corresponds to a multi-product enzyme that can also be used for the preparation of other cyclic sesquiterpenes such as a-copane , p-cubebeno, germacrene O, and elemol, besides o-cadineno (Fig. 2). In a preferred embodiment, the polypeptide comprises a sequence that has at least 90% identity with SEO ID NO: 2, or with SEO ID NO: 2 modified with at least one substitution in an amino acid that alters sesquiterpene synthase activity and / or product specificity. Said substitution is preferably selected from at least 25 one of the group consisting of: to. a substitution of the cysteine at position 455 with glycine (C455G), and b. a triple substitution of serine at position 416 by threonine, glycine at position 417 by threonine, and serine at position 418 by tyrosine (S "'T / G417TIS"' Y). 30 However, apart from the previous substitution, the optionally modified SEO ID NO: 2 may further comprise another substitution in an amino acid of its sequence, also to alter the specificity and / or distribution / rationalization of the sesquiterpenes it produces, and that is selected from: 35 a. a substitution of the serine at position 418 with histidine (S418H), when SEO ID NO: 2 comprises the C455G substitution, or b. a substitution of the serine at position 422 with alanine (S422A), preferably when SEO ID NO: 2 comprises the triple substitution S416T / G417T / S418y. It has been found that when the polypeptide of the invention comprises the SEO ID NO: 2 sequence modified with the C455G substitution, it mostly exhibits elemol synthase activity, which can be further increased when the additional S418H substitution. Thus, in a preferred example and under certain conditions, it is capable of producing elemol with a relative abundance, preferably in a range between 65% and 90%, and more preferably between 65% and 85% or between 75 % and 90%, with respect to the total amount of the different sesquiterpenes produced with said polypeptide. In addition, it was also found that when the polypeptide of the invention comprises the SEO ID NO: 2 sequence modified with the triple substitution S416T / G417T / S418y, it mostly shows germacrene D synthase activity. And in fact, in a preferred example and under certain conditions, it is capable of producing germacrene D with a relative abundance, preferably in a range between 75% and 80%, and more preferably between 75% and 80% or between 80% and 85%, with respect to the total amount of the different sesquiterpenes produced with said polypeptide. In another preferred embodiment of this aspect of the invention or any of its previous embodiments, and depending on the desired catalytic activity, the polypeptide of the invention comprises a sequence that is selected from the group consisting of: SEO ID NO: 2, SEO ID NO: 16 and SEO ID NO: 18. The SEO ID NO: 16 sequence polypeptide has elemol synthase activity, that is, it is an elemol synthase, which consists of the natural SEO ID NO: 2 polypeptide sequence of the CsTPS3 polypeptide modified at least with the substitution of the Cys at position 455 by Gly (C455G), and in which the amino acid 418 of its sequence is Ser or His, and more preferred is His. The SEO ID NO: 18 sequence polypeptide has germacrene D synthase activity, that is, it is a natural germacrene D synthase, which consists of the natural SEO ID NO: 2 polypeptide sequence of the CsTPS3 polypeptide modified at least with the triple substitution S416T / G417T / S418y, and wherein amino acid 422 of its sequence is Ser or Ala, and more preferably is Ser. In another preferred embodiment of this aspect of the invention or of any of its previous embodiments, the polypeptide is a sesquiterpene with no rate selected from the group consisting of: the CsTPS3 o-cadineno synthase consisting of SEO ID NO: 2, the elemol synthase VB2 consisting of SEO ID NO: 4, the elemol synthase Va5 consisting of SEO ID NO: 6, the germacrene O synthase VC1 consisting of SEO ID NO: 8 and the germacrene O synthase VC2 consisting of SEO ID NO: 1 O . Another aspect of the invention relates to a nucleic acid or polynucleotide comprising a sequence encoding a polypeptide of the invention, according to any one of those defined above. Throughout the present specification, said nucleic acid or polynucleotide, as well as in any of its preferred embodiments set forth below, can also be found interchangeably as "nucleic acid of the invention" or "polynucleotide of the invention". Preferably, the nucleic acid of the invention encodes an SEO ID NO: 13 sequence polypeptide. And more preferably, it encodes a modified SEO ID NO: 2 or SEO ID NO: 2 sequence polypeptide with at least one substitution in an altering amino acid. sesquiterpene synthase activity and / or product specificity, as defined above. In a preferred embodiment, when the nucleic acid encodes a polypeptide comprising the SEO ID NO: 2 sequence corresponding to the natural sesquiterpene synthase CsTPS3, it consists of a polynucleotide comprising SEO ID NO: 1. In another preferred embodiment, when the nucleic acid encodes a polypeptide comprising the modified SEO ID NO: 2 sequence, it consists of a polynucleotide comprising SEO ID NO: 1 with at least one mutation in its sequence selected from the group consisting of: to. a transversion T ..... G at position +1363 with respect to the start codon (ATG) of SEO ID NO: 1: y b. agroupfromsubstitutionsfromthenucleotidesT-NG-NAGC-TATinthe positions + 1246/1249 / 1252-1254 with respect to the start codon (ATG) of SEQ ID NO: 1. In a preferred embodiment of the above, the nucleic acid comprises another additional mutation in the SEO ID NO: 1 sequence polynucleotide that is selected from: to. a transverse / transition AG - + CA at positions +1252/1253 with respect to the SEO ID start codon NO: 1, when SEO ID NO: 1 understands the transversionT - + G; andb_ a transversion T - + A at position + 1264 with respect to the SEO start codon5 ID NO: 1, when SEO ID NO: 1 includes the substitution groupT ~ NG ~ NAGC ~ TAT. And in a more preferred embodiment of the above, the nucleic acid comprises the sequenceSEO ID NO: 15, which comprises said T - + G transversion in position +1363 and said 10 transversion / transition AG - + CA in positions +1252/1253; or the SEO ID sequence NO: 17, comprising said group of substitutions T - + A / G - + A / AGC - + TAT in positions + 1246/1249 / 1252-1254 and said transversion T _A in position + 1264 In another preferred embodiment of this aspect of the invention, the nucleic acid comprises the 15 minus a polynucleotide sequence selected from the group consisting of: SEO ID NO: 1, SEO ID NO: 3, SEO ID NO: 5, SEO ID NO : and SEO ID NO: 8. and preferably, it consists of SEO ID NO: 1, SEO ID NO: 3, SEO ID NO: 5, SEQ ID NO : o SEQ ID NO: 8. Another aspect of the invention relates to a gene construct comprising at least one nucleic acid of the invention, as any of those defined above. Also provided in the present invention are vectors containing the nucleic acid molecules described herein, thus constituting another aspect of the present invention. Vectors include plasmids (circular double stranded DNA molecules 25 self-replicable) for heterologous expression of eukaryotic protein in bacterial cells. Also provided in another aspect of the invention are bacterial cells or strains containing said vectors. The bacterial cells provided here can be cultured to induce the expression of the natural Cstps3 sequence, or in the absence of any of its modified (mutated) derivatives, and therefore the synthesis of the natural polypeptide CTPS3, or in the absence of the corresponding modified polypeptide (CsTPS3-VB2, CsTPS3VB5, CsTPS3-VC1 or CsTPS3-VC2). In another aspect, the invention relates to a method for obtaining a polypeptide of the invention with sesquiterpene synthase activity, which comprises culturing a bacterial cell transformed with a nucleic acid of the invention, or with a gene construct or a recombinant vector that understand it, as defined above, in suitable conditions to favor or induce the expression of said nucleic acid. In general, the induction method used depends to some extent on the type of expression vector used, which as a general rule in the case of commercial vectors is indicated by the manufacturer. Likewise, in order to achieve the best possible culture and induction conditions for each type of protein that is to be expressed, other variables such as temperature, induction time, culture medium used, etc. can be modified. With regard to the expression of sesquiterpene synthase type proteins in bacteria, the growth and induction conditions are well known and available to the skilled person in the state of the art, and can be varied at the discretion of the specialist. Technician in question. Another aspect of the invention refers to the use of the polypeptide of the invention for the synthesis, preferably in vitro, of sesquiterpenes. According to the present invention, the polypeptide of the invention makes it possible to synthesize a sesquiterpene that is selected from at least one of the group consisting of: a-cubebeno, a-copaeno, j3-cubebeno, j3-elemene, agurjuneno, E-j3-karyophylene, a-humulene, germacrene D, bicyclogermacrene, a-muurolene, abulneseno, cubebol, O-cadineno, elemol, germacreno 0-4-01, bulnesol, guaiol and any combination of two or more of the above. More preferably, the sesquiterpene that is synthesized is at least one selected from the group consisting of: ocadinene, elemol and germacrene D, or a combination of any two or more of the foregoing. In particular, and as mentioned above, the o-cadineno synthase CsTPS3 (SEQ ID NO: 2) on the one hand can be used in the synthesis o-cadineno and also of other cyclic sesquiterpenes such as a-copaeno, j3-cubebeno, germacrene D, and / or elemol. On the other hand, the modified TPS product of the invention can be used to improve the production and / or biosynthesis of elemol, germacrene D, a-gurjuneno, bicyclogermacrene, guaiol, bulnesol and j3-elemene, increasing the distribution of these sesquiterpenes in comparison to the relative amount of o-cadineno, j3-cubebeno, cubebol and a-copaeno, main products of the catalytic activity of the natural reference protein CsTPS3. This fact can result in methods to increase the production and / or purity of elemol, germacrene D, a-gurjuneno and bicyclogermacrene, guaiol, bulnesol and j3-elemene, increasing the recovery of these cyclic sesquiterpenes from the reaction medium. An example of this are those modified polypeptides that generate elemol as a main product, in addition to a small part of guaiol and bulnesol, and only traces of a-copane, 3D Germacrene D, o-cadinen, compared to the relative abundance of these sesquiterpenes produced by natural polypeptide CsTPS3 (SEO ID NO: 2) under the same conditions. Specific example of such modified polypeptides is that identified with the SEO ID NOA reference (CsTPS3-VB2), which contains the C45SG replacement. The introduction of the S418 H change in the CsTPS3-VB2 polypeptide has a synergistic effect on the production of elemol. An example of such a modified polypeptide is that identified with the SEO reference ID NO: 6 (CsTPS3-VB5). The invention also provides a modified polypeptide that produces a greater relative abundance of germacrene O, and a decrease in the percentage of other minor sesquiterpenes, compared to the relative abundance of this sesquiterpen or produced under the same reaction conditions by the natural CsTPS3 polypeptide ( SEO ID NO: 2). For example, simultaneous amino acid substitutions at positions 416, 417 and 418 cause an increase in the percentage of germacrene O, compared to the relative abundance of this sesquiterpene produced under the same conditions by the natural CsTPS3 polypeptide. Notably, the S416T / G4 17T1S418y replacements increase the production of ~ -elemene and a-gurjuneno to the detriment of the synthesis of a-copaeno, ~ -cubebeno and o-cadineno. An example of such a modified polypeptide is that identified with the SEO reference ID NO: 8 (CsTPS3-VC1). The modified polypeptides of the invention can be used for the preparation of elemol (Fig. 2), a cyclic sesquiterpene present in some essential phytoaceites. In several recently published scientific articles, it has been described that elemol is a potent repellent agent for different species of mosquitoes that transmit contagious diseases, and even an effective cockroach repellent. This fact has made elemol a promising and powerful natural repellent that can be used in pharmacological formulas designed to repel insects that transmit serious infectious and contagious diseases. Thus, in a preferred embodiment of use, the polypeptide of the invention is used for the preparation or synthesis, preferably in vitro, of elemol, preferably when said polypeptide comprises the SEO ID sequence NO: 16, more preferably when it comprises the SEO ID sequence. NO: 4 or SEO ID NO: 6, and even more preferably when its sequence is SEO ID NO: 4 OR SEO ID NO: 6. Considering the previous use, referring to the synthesis of sesquiterpenes with the polypeptide of the invention, another aspect of the invention relates to a method for synthesizing at least one of said sesquiterpenes, hereinafter method of the invention, comprising: to. incubating the farnesyl pyrophosphate substrate with at least one polypeptide of the invention, a single polypeptide or a combination of polypeptides can be used according to their ability or activity to synthesize different sesquiterpenes, and depending on the sesquiterpene or combination of sesquiterpenes to be prepared, and 5 b_ allow to react until obtaining a volatile product comprising at least onesesquiterpene Thus, methods for the synthesis of cyclic sesquiterpenes in which the acyclic farnesyl pyrophosphate (FPP) precursor is added to the mixture of 10 reaction that contains the natural protein CsTPS3, or failing any of the modified polypeptides (CsTPS3-VB2, CsTPS3-VB5, CsTPS3-VC1 or CsTPS3-VC2), under reaction conditions that favor the formation of cyclic sesquiterpenes. The average expert can easily identify and have at your disposal the conditions of the Method of the invention that favor the formation of cyclic sesquiterpenes, being widely known and customary for any expert in the field of enzymes (eg buffers, cofactors, temperature, solvent, induction time, etc.) and in particular those referred to enzymes with sesquiterpene activity without rate, and which by way of example would include, among others, those explicitly specified in example 4 of this 20 invention. Such conditions will be suitable, for example, to produce the substrate binding to the active center responsible for sesquiterpene activity without charge, to preserve the enzymatic function, etc. In a section of the methods described here, the stage of contact of the FPP with the Sesquiterpene synthase is performed in vitro, adding the crude protein extract containing the natural TPS CsTPS3 or any of the modified polypeptides to the reaction mixture containing the FPP substrate and magnesium as a cofactor. The sesquíterpenes produced by the methods of the invention include, but are not limited to & -cadinene, (X copaeno, ~ -copaeno, ~ -cubebeno, germacreno D and elemol (Fig. 2). In some cases, at 30 minus one of the major cyclic sesquiterpenes is & -cadinene, germacrene D or elemol. It is understood that both the above general description and the following detailed description constitute examples and explanation of the invention, and therefore are not restrictive of the claims of the invention. A detailed and explanatory description of the materials and methods, as well as the results resulting from the invention, will be made below. EXAMPLE 1. Analysis of sesquiterpenes extracted from the orange tree In citrus fruits the essential oils rich in terpenes accumulate in the flavedo (skin), and specifically inside the oil glands (multicellular secretory structures). The flavedo is the outer and colored part of the skin of citrus fruits (exocarp), which consists of a protective cuticle and an epidermis formed by parenchymal cells that surround the oil glands. Citrus essential oils are a mixture of different volatile compounds that are characterized by having a high content of hydrocarbon terpenes and relatively low amounts of oxygenated terpenes (Hognadóttir and Rouseff, [2003] J. Chroma! Ogr. A. 998, 201- 211). The organoleptic properties (taste and aroma) of citrus essential oils are the result of the combination of all of them. Materials and Methods: The composition of sesquiterpenes of the flavedo of oranges of the Navel variety was studied at different stages of the development of the fruit (green-immature, green-ripe, and ripened colored fruits), by gas chromatography analysis coupled to the spectrum Mass tometria (GC-MS) (Rodriguez et al. [2011]. Plan! Physiol. 156, 793- <302). To do this, the flavedo was mounted with the use of a sharp knife and immediately frozen in liquid nitrogen (N2). The frozen flavedo was crushed in liquid N2 with the help of a mortar hand until a very fine powder was formed. Two hundred milligrams (200 mg) of crushed flavedo were mixed with 3ml of cold pentane and 25 Jlg of 2-octanol (Sigma-Aldrich) in a Pyrex tube with screw cap. The tissue was homogenized on ice for 30 s with a Politron (PT 10-35 GT), stirred for 15 s with the help of a vortex, 3 ml of Milli-O water was added and stirred again in the vortex for 30 sec. The suspension was clarified by centrifugation at 1800 9 for 10 min at 4 ° C. The organic phase was extracted with a Pasteur pipette and placed in a clean tube. The aqueous phase was extracted twice with 3 ml of pentane, each time recovering the organic phase in the same tube. A 2 JlI aliquot of the organic phase was injected directly into the GC-MS for volatile analysis. At least two extractions and two independent injections were performed for each sample. A Thenno Trace GC Ultra gas chromatograph coupled to a Thermo DSa mass spectrophotometer with an electron ionization method (El) set at 70eV was used for volatile analysis. The ion source and transfer line were set at 200 and 260 ° C, respectively. Volatile compounds were separated on an HP-INNQWax column (Agilent J&C Columns) 30 m long x 0.25 mm internal diameter x 0.25 iJm phase thickness. The heating of the column was programmed at 40 ° C for 5 min, increasing to 150 ° C at the rate of SOC / min, and then at 250 ° C at the rate of 200C / min, keeping at 250 ° C for 2 min. of the injector was 220 ° C. As carrier gas, helium was used at a flow rate of 1.5 ml / min and the sample was injected without fragmentation. The mass spectrum produced by the impact of electrons was recorded at a speed of 0.5 / scan. Volatile compounds were identified by approximation of the mass spectrum obtained with that corresponding to that of the compounds present in the reference libraries (Wiley6 and NIST), or by their identity with the standard compound. The relative abundance of the volatile sesquiterpenes identified was calculated by integrating the area of the total ion chromatogram (TIC) peaks and normalizing the values with the recovery rate of the standard used as internal control (2-octanol). Results: The volatile sesquiterpenes identified in the extracts of the flavedo of Navel oranges at different stages of development are shown in Table 3. The results show significant differences in the type of compounds and their relative abundances between ripe and immature fruits. A total of ten cyclic and five acyclic sesquiterpenes account for less than 0.7% of the total volatile terpene content identified in the flavedo. These results are in accordance with previous results from other authors, which show that orange flavedo oil contains relatively low levels of hydrocarbon sesquiterpenes (Shaw PE, [1979] J Agr Food Chem. 27, 246-257; Sawamura M, [ 2000] In Recent Research Development in Agricultural and Food Chemestry, Pandalai SG [Ed], Research Signpost, Trivandrum -India, Vol. 4, pp 131-164; Mitiku et al, [2000] Flav Frag J. 15, 240-244 ). In addition, our results demonstrate that the relative abundance of each sesquiterpene identified, as well as the relative abundance of the sum of all of them, changes through the development of the fruit. With the sole exception of Valencian and a-farneseno, all other sesquiterpenes listed in Table 3 were identified both in the flavedo of green fruits (immature and ripe), as in ripe fruits that had undergone the color change. A-farneseno was identified only in immature green fruits, while Valencia - an indicator of fruit maturity (Elston et al., [2004] Flav Frag J. 20, 381-386) - was only identified in ripe fruits They had undergone the color change. In this sense, the accumulation of Valencian in ripe orange fruits that begin to undergo color change, has been correlated with the induction of the expression of the Cstps1 gene, which encodes a cyclase with Valencian synthase activity (Sharon-Asa et al. ., [2003] Plant J. 36, 664-674). As expected, our results also show that monoterpenes form more than 98% of the total volatile content of the flavedo of Navel oranges. Although limonene is the most abundant hydrocarbon monoterpene (> 91%) (data not shown), it has been suggested that its apparent aromatic activity is due to co-elution and contamination with other compounds such as alcohols oxygenated It is known that the most intense aroma of the essential oil of oranges is due to the presence of terpenes whose concentrations are relatively very low. The characteristic sweet and fresh odor of the oranges' skin is mainly due to (X-y 3sinensal (0.02%), whose detection threshold is only 0.05 ppb (H6gnadóttir and Rouseff, (2003] J. Chromatogr. A. 998, 201-211). TABLE 3 Composition of sesquiterpenes of the flavedo of Navel oranges. Sesquiterpene analysis was performed on flavedo extracts using GC-MS. Sesquiterpenes were identified by coincidence of retention time (RT) and mass spectrum (MS) of the available standards, or by coincidence the mass spectrum of the compounds present in the reference libraries. The data correspond to the relative amounts of each sesquiterpene identified, represented in the form of percentage (%) of area with respect to the total area of the chromatogram peaks. The results correspond to the average value of three biological replicates and their corresponding standard deviations. Green-immature Green-ripe Mature %%% Cyclic Sesquiterpenes a-Copaeno p-Cubebeno p-Elemeno p-Copaeno a-Humuleno Germacreno OR a-Muuroleno Valenceno or-Cadineno ¡3-Sesquifelandreno Elemol Relative total Acyclic sesquiterpenes Z-¡3-Farneseno a-Farneseno Nerolidol ¡3-Sinensal a-Sinensal Relative total 0.0213 ± 0.0013 0.0169 ± 0.0056 0.0424 ± 0.0018 0.0029 ± 0.0004 0.0122 ± 0.0010 0.0135 ± 0.0022 n.d.n.d.0.0340 ± 0.00220.0093 ± 0.00210.0078 ± 0.0020 0.1603 0.0310 ± 0.0004 0.0540 ± 0.0081 0.0022 ± 0.0003 0.0781 ± 0.0029 0.1073 ± 0.0024 0.2726 0.0304 ± 0.0036 0.0226 ± 0.0001 0.0422 ± 0.0022 0.0245 ± 0.0001 0.01 11 ± 0.0011 0.0279 ± 0.0018 0.0093 ± 0.0024 n.d. 0.0542 ± 0.0001 0.0115 ± 0.0004 0.0161 ± 0.0004 0.2497 0.0170 ± 0.0003 n.d. 0.0065 ± 0.0007 0.0463 ± 0.0020 0.0468 ± 0.0004 0.1166 0.0261 ± 0.0010 0.0180 ± 0.0007 0.0485 ± 0.0055 0.0294 ± 0.0004 0.0054 ± 0.0005 0.0153 ± 0.0003 0.0082 ± 0.0010 0.0915 ± 0.0049 0.0425 ± 0.0029 0.0055 ± 0.0001 0.0132 ± 0.0012 0.3035 0.0102 ± 0.0034 n.d 0.0053 ± 0.0015 0.0277 ± 0.0012 0.0295 ± 0.0013 0.0727 Although there have been many sesquiterpenes that have been identified in citrus essential oils, only two citrus genes encoding enzymes with sesquiterpene synthase activity have been isolated and cloned. The CjFS gene (GenBank accession number: AF374462), which encodes a polypeptide with farneseno synthase activity, was isolated from young leaves of kuzu (Ci / rus junos) (Maruyama et al., (2001) Biol Pharm BuJ /. 24, 1171-1175); And the Cstpsl gene (N 'access GenBank: AF441124) that encodes a Valencian synthase, was isolated from the flavedo of oranges (Sharon-Asa et al. (2003) Planl J. 36, 664-674; WO 20051021705, Ministry 01 Agriculture of Israel, March 10, 2005). The great diversity of sesquiterpenes with aromatic activity that have been identified in citrus fruits and the little information available about the TPS enzymes responsible for their biosynthesis, was the reason why we were encouraged to isolate and clone new sesquiterpene synthase genes from orange. EXAMPLE 2. Isolation of the coding region of a new orange sesquiterpene synthase gene Materials and methods. Isolation of total RNA from the orange flavedo and cONA synthesis. The flavedo (exocarp) of Navel oranges (Citrus sinensis var Washington Navel) was carefully separated from the albedo (mesocarp) to prevent contamination, and immediately froze in liquid N2. Then the flavedo was also triturated in liquid N2 with the help of a grinder to form a very fine powder, and the total RNA was isolated using the RiboPure ™ (Ambion) system. The contaminating genomic ONA was removed from total RNA by enzymatic digestion with ONase using the Turbo ONA-free ™ system (Ambion), following the manufacturer's recommendations. The concentration of the total RNA solution was determined with a NO-1000 spectrophotometer (NanoOrop Technologies, Inc.). Total RNA quality was evaluated by the standardized 3% agarose denaturing gel electrophoresis method, visualizing the integrity of ribosomal RNA bands of different sizes. The total RNA of the oranges was used to synthesize polyadenylated RNA (poly RNA (An using the MicroPoly (A) Purist ™ (Ambion) system, following the manufacturer's instructions. The integrity of the total RNA poly (A) "'" is verified by electrophoresis in a gel denatured 1.6% agarose. The synthesis of the 1st cONA chain (1st cONA) of the poly (A) "'" RNA was performed using the system RetroScript® (Ambion) and oligo (dT) As a primer for MMLV Reverse Transcriptase, following the manufacturer's instructions, the 1st cONA solution was stored at -20 ° C until use. Isolation of the Estifieante region of the Cstps3 gene from the orange flavedo: The 1 SI cONA solution prepared as described above was used as a template for the amplification of the entire coding region (cONA) of an orange tree gene (Cstps3) encoding a new sesquiterpene without fee. Oligonucleotides designed on truncated EST sequences encoding a polypeptide with sesquiterpene synthase homology were used as primers in PCR reactions. For the amplification of the Cstps3 gene cONA, the oligonucleotides listed in Table 4 and the Advantage® HF 2 PCR system (Clontech) were used as primers, following the manufacturer's instructions. To facilitate cloning of the amplified fragment, both oligonucleotides were added a unique restriction site at their 5 'end, both protected by two additional nucleotides. To the direct primer (TPS3-F) the sequence corresponding to the restriction site of the BamH I endonuclease (GGATCC) was added, just before the ATG codon. To the reverse primer (TPS3-R) was added the restriction site of the endonuclease Salt I (GTCGAC), just after the stop codon (TGA). The amplified ONA fragment was purified from a 1% agarase gel using the PureLink ™ Quick Gel Extraction system (Invitrogen), following the manufacturer's instructions. The eluted ONA fragment was concentrated by centrifugation with the Microcon® Centrifugal Filters (Millipore) system to a volume of 10! JI, following the manufacturer's instructions. The purified DNA fragment was cloned into plasmid pCR®4Blunt-TOPO using the Zera Blunt® TOPO PCR Cloning Kit for Sequencing (Invitrogen) system. 2! J1 of the ligation reaction were used to transform electrocompetent cells of the strain One Shot® TOP10 (Invitrogen) of the Eseheriehia eoli bacteria, following the manufacturer's instructions. Plasmid ONA was isolated from transformants using the Wizard® Plus SV Minipreps ONA Purification System (Promega) system, and the clone CONA fragment of the cloned Cstps3 gene was sequenced using primers T3 (5'-ATIAACCCTCACTAAAGG-3 ') and T7 ( 5'-TAATACGACTCACTATAGGG3 '). The sequences obtained were analyzed using the Sequencher v4.9 software (Genes Codes Corporation, Ann Harbor, Michigan). Results: The expression of an EST (gxpressed ~ equeneed Lag) of the mandarin x orange hybrid Citrus reticulata var. Clementine (GenBank accession number: CX29260B), with homology to terpene cyclase of Class I plants (NCBI COO: cd00868), was determined to be induced in the flavedo of ripe green fruits of Navel orange, with respect to fruits mature who had undergone the color change. The nucleotide sequence of this DNA fragment was used as a bait to search for homologous orange sequences in the GenBank ESTs database, using the BLASTN algorithm (http://blast.ncbi.nlm.nih.gov/Blast.cgi ). The analysis allowed the identification of several ESTs Navel orange trunks: CK935484, CK935772, CK937172, EY703037, EY708586, EY731065, EY713717, EY722034, and EY732650, which overlapped the Clementine EST used as bait. The alignment of the ESTs identified by CLUSTALW analysis (Thompson et al., [1994] NucJeic Acids Res. 22, 4673-4680) (Fig. 4), revealed a high degree of similarity between the overlapping regions. This fact allowed the assembly of the overlapping sequences in a full-size consensus sequence (from the ATG codon to the stop reading codon). The consensus sequence was assembled using the "Assambly" algorithm of the Sequencher v4 .8 software (Gene Codes Corporation, Ann Harbor, Michigan). The consensus sequence predicted a cONA with an open reading frame (ORF: Qpen Reading Erame) of 1695 nucleotides in length, encoding a 564 amino acid polypeptide. The comparison of the deduced amino acid sequence of this polypeptide with the protein sequences of the non-redundant GenBank database (http://www.ncbi.nlm.nih.gov/Blast.cgi). using the BLASTP algorithm, it was revealed that said polypeptide had homology with vegetable sesquiterpene synthases. Since there was no prior evidence that the nucleotide sequence assembled here could effectively correspond to the cONA of an orange tree gene encoding a new sesquiterpene synthase, primers were designed on the consensus sequence in order to amplify the ORF proposed here. Using the oligonucleotides listed in Table 4 as primers and as temperate the single chain cONA prepared from the total RNA isolated from the Navel orange flavedo, a DNA fragment of the expected size (1695 bp) was amplified. The size of the amplified fragment was confirmed by electrophoresis on an agarose gel (1%). The PCR product was cloned into the pCR®4Blunt-TOPO vector (Invitrogen), and the nucleotide sequence of the recombinant clone insert was determined. Sequence analysis confirmed that the cloned cONA fragment effectively corresponded to the complete ORF of the Cstps3 gene isolated from the Navel orange flavedo, which was identified with the SEO ID reference number NO: 1. BLASTN analysis of the sequence deduced from Amino acids of the polypeptide encoded by the SEO ID NO: 1 sequence, here identified as SEO ID NO: 2, revealed that the encoded protein had homology to sesquiterpene synthase plants of the Tps-a class (NCBI Conserved Domain Database: cd00684). The nucleotide sequence of the ORF isolated here (SEO ID NO: 1), as well as the amino acid sequence of the encoded protein (SEO ID NO: 2) is shown in Figs. 1A and 2A. The cDNA fragment isolated here was named as Cstps3 (SEO ID NO: 1), following the nomenclature of Sharon-Asa and coL, [2003] Plant J. 36, 664-674. These authors isolated the first orange sesquiterpene synthase gene, which they named Cstps1 (International Patent Application WO 2005/021705, Ministry of Agriculture of Israel, March 10, 2005). TABLE 4 List of oligonucleotides used as primers for amplification of the coding region of the Cstps3 gene of the Navel orange fruit flavedo. SEQ ID NO Oligonucleotide Sequence (5'_ 3 ') 11 TPS3-F CGGGATCCCATGTCTTTGGAAGTTTCAGCCTC 12 TPS3-R CGGTCGACTCATACACATATCGGCACAGG EXAMPLE 3. Sequence and phylogenetic analysis of the orange tree CONA coding for sesquiterpene synthase CsTPS3 (SEO ID NO: 2) Results: In general, vegetable sesquiterpene synthase has a molecular weight of 50 -100 KDa, with a length between 550-580 amino acids (Bohlman et al., [1998] Proc. Nat !. Acad. Sci. USA. 95, 4126- 4133). The cDNA of the Gstps3 gene (SEO ID NO: 1) isolated from the flavedo of Navel oranges object of the invention, encodes a protein of 564 amino acids (SEO ID NO: 2) with a molecular weight (MW) of 65.38 KDa. The estimated PM of the CsTPS3 protein is in accordance with that estimated for other sesquiterpene plant syntheses, which supports our initial hypothesis that the PCR fragment isolated here corresponds to an OFR encoding a complete protein. The BLASTP analysis revealed that the deduced amino acid sequence of the CsTPS3 polypeptide (SEO ID NO: 2) has similarity to germacrene D synthases (GerD) of other species of Rósidas, as well as to the GerD of kiwi (Asteracea). The CsTPS3 polypeptide showed between 54-66% identity to sesquiterpene synthases of the Tps-a subfamily (Bohlman et al., [1997] J. Biol. Chem. 272, 21784-21792), ingesting the grape GerD (AAS66357 ), rose (B0105086), California poplar (AAR99061), and kiwi (AAAX16121), and the GerB of Gistus creticus (ACF94469). The sesquiterpenes synthases of the Tps-a subfamily contain two structural domains: (/) an N-terminal domain with glycosyl hydrolase activity, and (ii) an e-terminal domain that comprises the active site of the enzyme. The conserved domains DDXXD, NSE / DTE and RXR that are present in all plant sesquiterpenes synthases (reviewed by Degenhardt et al. (2009) Phytochemistry 70, 1621-1637), are also conserved in the CsTPS3 polypeptide (Fig. 5) The DDXXD and NSElDTE domains are involved in the cooperative bond of three Mg + 2 atoms that stabilize the pyrophosphate group of the FPP substrate, while the RXR domain is involved in the sequestration of the diphosphate group, so that keeps it away from the hydrophobic cavity while promoting the formation of different highly reactive carbocations that are formed during catalysis, and comparing the sequence of the polypeptides analyzed revealed that other highly conserved amino acid residues and that are essential for the activity of the tobacco 5-epi-aristoloquene synthase model protein (TEAS) (Starks et al., [1997] Science 277, 1815-1820), are also conserved in CsTPS3 polypeptide. Interestingly, only the first threonine residue of the tetrad 401TTTy40S involved in the catalytic activity of TEAS, is conserved in the homologous sequence 41STSGS418 of the CsTPS3 polypeptide (Fig. 5). The residue G '"is conserved in the GerD of populus and kiwi. As well as in the GerB of C. creticus. On the other hand, the last position of the tetrad is occupied by a serine residue (S418) in the CsTPS3 polypeptide, while in the rest of the proteins present in the alignment they have a tyrosine residue (Y) conserved in said position (Fig. 5). These observations suggest that the amino acids that make up the tetrast 41STSGS418 could be involved in the product specificity of the orange CsTPS3 protein (SEO ID NO: 2) object of the invention The tyrosine residue at position 278 (y278) of TEAS, which is conserved in all cyclic sesquiterpenes synthases, is also in the CsTPS3 polypeptide. This fact supports our hypothesis that the CsTPS3 protein corresponds to a cyclic sesquiterpene synthase.It has been suggested that the residue and 278 stabilizes the positive charge of the carbocationic intermediate that precedes the eta FPP cycling cycle (Maruyama et al. [2001] Biol Pharm Bull. 24. 1171-1175; Chang et al. [2005] Biolechnol. Letl 27,285288). The phylogenetic analysis of the deduced amino acid sequence of the CsTPS3 protein (SEO ID NO: 4) object of the invention, with that of other sesquiterpene synthases with proven germacrene O and cadineno (Cad) synthase activity, groups the CsTPS3 with Gero de other species of Rósidas (Vitis vinefera, Rosa hybrid, Populus trichorcapa, and Cistus creticus,) and with the asterácea Actinia deliciosa (Fig. 6). The Gero of the monocotyledonous Zingiber officinale and the cubebeno synthase (Cub) of the gymnosperm Magnolia grandiflora grouped separately from the sesquiterpene cyclase of dicotyledonous. EXAMPLE 4. Biochemical characterization of the Sesquiterpene Syntase activity: Heteropological expression of the CsTPS3 protein in bacterial cells, Preparation of cell-free protein extracts and in vitro assay of the Sesquiterpene Syntase activity The catalytic activity of the CsTPS3 protein (SEO ID NO: 2) was tested in vitro using protein extracts prepared from cells of the bacterial strain Escherichia coli BL21 (DE3) carrying the coding region of the Cslps3 gene (SEQ ID NO: 1 ). which had previously been cloned into the expression vector pET45b (+). Protein extracts prepared from E. coli BL21 (OE3) cells transformed with the empty vector pET45b (+) were used as a negative control. The functional characterization of the new orange sesquiterpene synthase CsTPS3 (SEO ID NO: 2) isolated here, revealed that said protein is a multifunctional sesquiterpene syntheses. Biosynthesis of multiple sesquiterpenes is a characteristic of the vast majority of sesquiterpenes without isolated rates of different species. vegetable, and it is well documented in the state of the art (Lesburg and airas, [1997J Seienee 277, 1820-1824; Starks et al., [1997J Science 277, 1815-1820; Steel et al., [1998J J. Biol. Chem. 273, 2078-2089; Carulhers et al., [2000J J. Biol. Chem. 275, 25533-25539; Rynkiewicz et al., [2001J Proe. Natl. Acad. Sci. USA. 98, 13543-13548; Arimura et al., [2004J Planl J. 37, 603-616; Lüeker et al., [2004J Pholochemislry 65, 2649-2659; Deguerry et al., [2006J Arch. Bioehem. Biophys 454, 123136; Pieaud et al., [2006J Areh. Biochem Biophys 452, 17-28; Jones et al., [2008J Areh Biochem Biophys. 477, 121-130; Sungbeom and Chappell [2008J Planl Physiol. 147, 10171033; Nieuwenhuizen et al., [2009J J Exp Bol. 60, 3203-3219; Dunner et al., [2011J Phytoehemislry 72, 897-908). Materials v Methods: The orange CONA fragment with the correct ORF encoding a polypeptide with sesquiterpene synthase homology, was phase subcloned between the BamH I and Salt I restriction sites of the expression vector pET45b (+) (Novagen), using the Rapid ONA Ligation Kit (Roche) system. Competent NovaBlue cells (Novagen) were transformed with a small aliquot of the ligation reaction, following the manufacturer's instructions. The recombinant plasmids pET45b (+) carrying the ONA encoding the new orange sesquiterpene synthase CsTPS3 (SEO ID NO: 2) were selected in Luria-Bertani (LB) medium supplemented with ampicillin (50) .. Ig / ml). Plasmid ONA extracted from recombinant clones was sequenced to verify the presence of the coding region of the Cstps3 gene (SEO ID NO: 1) in the correct orientation and reading frame, before transforming an appropriate expression host. For the production of the CsTPS3 protein, as well as their respective mutant forms, the recombinant plasmids were transformed into the BL21 (OE3) expression cells (Novagen). This strain is a bacteriophage A.OE3 lysogen, a derivative of bacteriophage A. that carries the immunity region of bacteriophage 21 and an ONA fragment of the lac / gene, the lacUV5 promoter, and the T7 transposon RNA polymerase gene . This fragment inserted into the ¡nt gene prevents the integration or excision of the OE3 lysogen from the chromosome in the absence of an assistant bacteriophage. The only promoter that directs the transcription of the T7 RNA polymerase gene is the lacUV5 promoter, which is induced by adding IPTG to the culture medium. The expression of the target gene fused in phase to the open reading frame of the T7 promoter is activated after induction of RNA T7 polymerase. Following the production of the protein of interest in the cytoplasm of recombinant bacterial cells, two methods were used for the preparation of cell-free protein extracts and the subsequent in vitro assay of sesquiterpene synthase activity. Ezyme 1: A colony of the bacterial strain (isogenic AD3) carrying the recombinant pET45 vector was inoculated in 10 ml of LB medium supplemented with 50 Ilg / ml carbenicillin, 34 ~ g / ml chloramphenicol and 0.5% glucose. The pre-inoculum was incubated overnight at 37'C with shaking (250 rpm). The culture was used to inoculate 100 ml of supplemented LB medium as described above, and was grown at 37 ° C to a D0600 of 0.6 Induction was carried out after adding 1 mM IPTG to the culture. Incubation was continued overnight at 18 ° C. The cells were precipitated by centrifugation and resuspended in 1ml of the SSAB buffer (100 mM sodium phosphate pH 7.0, 10 mM MgCI2, 1 mM DTI, 10% v / v glycerol; Prosser et al., [2002) Phytochemistry 60, 691 -702). The cells were lysed by three / five freeze / thaw cycles, followed by the addition of 7.5 KU of rLisozyme (Novagen) for each ml of the SSAB buffer. The cell suspension was incubated at room temperature on a platform with low speed agitation for 15 min. The DNA present in the lysate was digested with 25 U of Benzonase Nuclease (Novagen) per ml of the SSAB buffer. The cell suspension was incubated at room temperature and at low speed for 20 min until the viscosity completely disappeared. At this time the tubes were incubated on ice. The cellular debris was removed by centrifugation at 13,000 rpm for 30 min at 4 ° C. The crude protein extracts were used for in vitro testing of sesquiterpene synthase activity, using FPP (161lg FPP / ml protein extract) as a substrate. Enzymatic tests were carried out in glass vials with PTFE stopper using 500 III of raw lysate supplemented with 16 Ilg of FPP. The reaction was covered with 500 III pentane and the tubes were incubated overnight at 30 ° C. After the incubation period, volatiles were recovered from the pentane layer and extracted twice from the aqueous phase using 1 ml of pentane each time. The pentane fractions were combined and concentrated to 50 IlL under nitrogen atmosphere, and finally analyzed by gas chromatography coupled to mass spectrophotometry (GC-MS). A Thermo Trace GC device was used coupled to a mass spectrophotometer with electron ionization mode (El) at 70 eVo Volatile compounds were separated on an HP-INNOWax column (30 mx 0.25 mm id x 0.25 ~ m film) (Agilent J&C Columns). The sample was injected without fragmentation and the oven was programmed as follows: 40 ° C for 5 min, subsequently the temperature was increased to 150 ° C at a rate of 5 ° C / min, and finally at 250 ° C for 2 min (at a rate of 20 ° C / min). The injector temperature was 220 ° C, and helium was used as the carrier gas at a constant flow of 1.5 ml / min. After the impact of electrons, the mass spectra were recorded in the range of 30-400 mIz with a scanning speed of 0.5 scans / s. The identification of the compounds was made by coincidence of the acquired mass spectra and the retention indices (RI) with those corresponding to the authentic patterns available, or with those sesquiterpenes present in the reference database (Wiley and NIST) . Enzymatic egg 1 /: BL21 cells (DE3) carrying the recombinant pET45b vector expressing sesquiterpene synthase CsTPS3 or any of its modified versions were grown at 37 ° C in Terrific Broth medium (TB) supplemented with 50 Jlg / ml carbenicillin up to one D0600 of 0.6. Cells were induced with 1 mM IPTG for 16 h at 18 oC. Bacterial cultures grown overnight and expressing recombinant proteins were centrifuged to collect the cells. The cells were resuspended in wash buffer (20 mM TrisHCI, pH 7.0, 50 mM KCI) by vortexing, and subsequently centrifuged. The cells were washed with 1 ml of protein extraction buffer (50 mM 3- (N-morpholino) -2-hydroxypropanesulfonic acid, pH 7.0, 10% [v / v] glycerol, 5 mM MgClz, 5 mM DTI, 5 mM sodium ascorbate, 0.5 mM phenylmethylsulfonyl fluoride), and subsequently stirred, sonicated and centrifuged. After recovering the supernatant, the extraction buffer was changed by the enzyme assay buffer (10 mM 3- (N-morpholino) -2-hydroxypropanesulfonic acid, pH 7.0, 10% [v / v] glycerol, 1 mM DTT ) using PD-10 columns (GE Healthcare Life Sciences). Enzymatic assays were carried out in glass vials with PTFE screw cap, using 500 JlI of crude lysate supplemented with 10 Jlg FPP, MgClz (20 mM), and phosphatase inhibitors (0.2 mM NaW04, 0.1 mM NaF). The reaction mixtures were covered with 500 JlI of hexane and the tubes were incubated overnight at 30 ° C. Subsequently, the upper hexane phase was stirred with the aqueous phase and after centrifugation it was used for metabolite analysis. The hexane fractions were concentrated to 50 JlI under a nitrogen atmosphere and analyzed by gas chromatography coupled to mass spectrophotometry (GC-MS). The equipment used was a Hewlett Packard 6890 GC coupled to a selective mass detector (MSD) 5973 equipped with a 7683 multiple automatic injector, and equipped with an HP-5MS capillary column. The injection was performed without fragmentation and the oven was programmed as follows: from 50 ° C (5 min wait) to 250 ° C (5 min wait) at 5 ° C / min a. The injector temperature was 200QC and helium was used as a carrier gas with a constant flow of 1.5 ml / min. The source temperature of ions and quadrupole were 250 and 150 ° C, respectively. The mass spectrum after the impact of electrons was recorded in the range of 40-300 ml. The identification of the compounds was made by coincidence of the acquired mass spectra and the retention indexes (RI) with those corresponding to those of the authentic patterns available, or with those sesquiterpenes present in the NIST and MassFinder reference databases. The abundance of each product detected was quantified by integrating the areas of each peak using the Enhanced Chemstation version B.01 .00 software (Agilent Technologies). Results: The in vitro assay of sesquiterpene synthase activity carried out in any of the enzymatic assays I and 11, demonstrated that the Cstps3 gene canona uniquely encodes a sesquiterpene synthase activity polypeptide. Said activity was determined by the ability of the CsTPS3 polypeptide to transform the FPP substrate into cyclic sesquiterpenes. Enzymatic f: The results of the GS-MS analysis showed that the crude lysates of the bacterial cells expressing the recombinant protein CsTPS3, prepared according to enzymatic assay f, form as the main product Ocadineno (46.91%), in addition to other sesquiterpenes minority citrus (Table 5 and Fig. 7 A). The identification of the smallest peaks showed that they corresponded to cyclic sesquiterpenes ¡3-cubebeno (14.55%), germacrene D (11.8%), et-copaeno (9.65%), cubebol (7.11 %), elemol (5.93%), and bicyclogermacrene (4.05%). Despite its multi / unitary activity, the CsTPS3 polypeptide (SEO ID NO: 4), encoded by the Cslps3 cDNA (SEO ID NO: 2), was classified as an O-cadinine without rate, based on the relative abundance of the o-cadineno. The designation of multifunctional sesquiterpene synthases based on their majority product is a general standard well known in the state of the art. The molecular structure of the products formed by the CsTPS3 polypeptide is shown in Fig. 2. The control corresponding to BL21 cells (OE3) transformed with the empty pET45b vector, did not produce any of the volatile compounds synthesized by the multifunctional enzyme CsTPS3, This demonstrates that the volatile sesquiterpenes identified in the extracts prepared from the cells that express the coding region of the Cstps3 gene (SEO ID NO: 1), are the product of the catalytic activity of the CsTPS3 enzyme. Enzymatic test 1 /: When the cyclase activity of the CsTPS3 polypeptide was tested under the conditions of enzyme test 11, a greater number of sesquiterpenes was identified (Table 6). This difference may be a consequence of the greater sensitivity of the GCMS equipment used in this test. The sesquiterpenes produced by the CsTPS3 polypeptide in enzyme tests f and 11 cannot be compared with each other, since the amount of recombinant protein added in each type of assay was not quantified. In the profile of volatile sesquiterpenes produced by the CsTPS3 polypeptide (SEO ID NO: 2) several sesquiterpenes were identified, of which O-cadineno was the majority product (27.36%) (Table 6 and Fig. SAl. The identification of minority peaks revealed that they corresponded to cyclic sesquiterpenes a-copaeno (19.60%), [3-cubebeno (14.30%), 5 germacrene D (9.36%), elemol (7.49%), cubeol (4, 42%), bicyclogermacrene (3.58%), 0muurolene (1.92%), germacrene D-4-ol (1.90%), a-bulnesen (1.69%), E-karyophylene (1.48 %), a-cubebeno (1.12%) Since O-cadineno was the majority product of the enzymatic activity of the CsTPS3 protein (SEO ID NO: 2), it was classified as an O-cadineno synthase. molecular structure of sesquiterpenes produced by the polypeptide 10 CsTPS3 is shown in Fig. 2. BOARDS Relative abundance of sesquiterpenes produced in vitro by the natural polypeptide CsTPS3 and their respective modified versions. The catalytic activity of the enzymes was tested according to the method described in the enzyme assay l. The data correspond to percentages (%) of area of each sesquiterpene with respect to the total area of the peaks detected in the volatile profile. Sesquiterpene a-Copaeno a-Gurjuneno [3-Cubebeno Germacreno D Bicyclogermacrene O-Cadineno Cubebol Elemol Guaial Modified polypeptides CsTPS3 VB2VBSVC1VC2 %%%%% 9.65 13.98 10.59 14.55 11, 8 77.6175.91 4.05 8.413.5 46.91 7.11 5.93 77.4987.78 22.51 12.22 TABLE 6 Relative abundance of sesquiterpenes produced in vitro by the natural polypeptide CsTPS3 and their respective modified versions. The catalytic activity of the enzymes was tested according to the method described in the enzymatic test 11. The data correspond to percentages (%) of area of each sesquiterpene with respect to the total area of the peaks detected in the volatile profile. Products with relative abundances of 1% or less are indicated as traces. Modified polypeptides CsTPS3 VB2 VB5 VCl VC2 Sesquiterpene%%%%% a-cubebeno 1.12tracestracestracestraces a-copaeno 19.601.66tracestracestraces j3-cubebeno 14.30traces j3-elemeno 2.40traces3.433.96 a-gurj uneno traces5.445.70 E-j3-Caryophylene 1.481.63tracestracestraces a-humuleno 3.582.71traces germacrene D 9.362.01traces84.4683.1 0 bicyclogermacrene 3.562.532.91 a-muurolene 1.92 a-bulneseno 1.691.48traces cubebol 4.421.07traces t5-cadineno 27.363.191.15tracestraces elemol 7.4966.7083.86 germacrene D-4-ol 1.90tracestraces2. 122.40 bulnesol traces15.4811, 44 It has been established that the formation of multiple sesquiterpenes by multifunctional sesquiterpene synthase enzymes occurs through the formation of different intermediate carbocationic structures (reviewed by Degenhardt et al., [2009] Photochemistry 70, 1621-1637). The cascade reaction begins with the dependent ionization of divalent metal ions and / or by the isomerization of the farnesyl pyrophosphate precursor (FPP). The resulting cationic intermediates undergo several intramolecular rearrangements such as: cyclisations, changes of hydride groups (migration of a hydrogen atom in a carbocation to the carbon atom with +1 charge from an adjacent carbon), or conformational transitions, until the reaction culminates by the loss of protons or activated by the addition of a nucleophilic molecule (a chemical species such as a hydroxyl group that donates a pair of electrons to an electrophilic molecule to form a chemical bond). The structural diversity of the products formed by sesquiterpene without fees is due to the large carbon skeleton (glue tail) of the FPP and the presence of three bonds double. The proposed mechanistic scheme for the formation of sesquiterpenes by the natural polypeptide CsTPS3 and shown in Figs. 9A and 98, tries to explain the relationship of its multiple products based on the information of the proposed reaction mechanisms for other vegetable sesquiterpenes synthases (Deguerry et al., [2006] Arch Biochem Biophys. 454, 123-136: Jones et al. ., [2008) Arch Biochem Biophys. 477, 121 130: Lee and Chappell, [2008) Plan! Physiol 147, 1017-1033: O'Maille et al., [2006) Arch Biochem Biophys. 448, 73-82: Pica ud et al., [2006) Arch Bioche Biophys. 452, 17-28: Starks et al., [1997) Science 277, 1815-1820: Yoshikuni et al., [2006), ehem Biol. 13, 91-98). The formation of cyclic sesquiterpenes from the FPP precursor by the orange sesquiterpene synthase CsTPS3 product of the invention can proceed through the formation of highly reactive and unstable carbocationic intermediates. This hypothetical mechanism would explain the formation of multiple products by the recombinant CsTPS3 protein expressed in bacteria, which were subsequently identified by GC-MS analysis. When the substrate E, E-FPP binds to the active site of the enzyme through the divalent magnesium cations (Mg2 +), the phosphate group is released forming the E, Efarnesyl cation (transoid-farnesyl cation), which can suffer a cyclization stage (ring closure 11.1; route a in Fig. 9A) to generate the C11 humulil macrocyclic cation. This can be deprotonated to form a-humulene (3.58% [Table6]), or undergo a 2.10 ring closure, followed by detonation of C3 carbon to form 3-Caryophylene [Table 6]. Alternatively, the isomerization of E, E-farnesyl cation on the C2-C3 link (route b in Fig. 9A) would form the necessary cation nerolidil intermediate for the formation of germacranon and cadinano sesquiterpenes. Different studies related to the use of radioactive analogs of FPP and nerolidyl diphosphate support the intermediation of nerolidyl cation in the reaction mechanism catalyzed by sesquiterpenes without fees (reviewed by Degenhardt et al., [2009] Photochemistry 70, 1621-1637). In a subsequent reaction stage, the Z, E-farnesyl cation could undergo a 10.1 ring closure to form the 3Z, 7E-germacradienyl cation. The direct detonation of the 3Z, 7E-germacradienil cation would form the minor product germacrene D. Alternatively, the hydroxylation of the 3Z, 7Egermacradienil cation in the C3 carbon would form the Germacrene 0-4-01 (route e in Fig. 9A). Since the germacranos are flexible molecules, the 3Z, 7E-germacradienil cation could easily undergo further transformations through the interconversion of the chair conformations of their respective isomers. The formation of different carbon skeletons would imply the subsequent cyclization of the conformers through the attack of carbocations on either of the two double bonds. Thus, the two conformers of the 3Z, 7E-germacradienil cation would lead to the formation of the cadinenil cations (route d in Fig. 9A) and muurolenyl (route e in Fig. 9A), respectively. Cadinenil cation generated by the CsTPS3 enzyme could undergo detonation in C7 and the subsequent formation of the double bond C6-C7 to generate O-cadineno as a majority product (46.91% according to the results of the enzymatic test I [Table 5], and 27.36% according to Enzymatic assay 11 [Table 6]). ~ -Cubebeno, one of the two most abundant by-products produced by CsTPS3 (14.55% [Table 5], and 14.30% [Table 6]), could be generated by migration of the hydrogen atom in C1 to C2 (migration of hydrogen 1,2), followed by electrophilic closure in 1,2 Y detonation of the cadinenyl cation. Alternatively, cadinenyl cation could also undergo other rearrangements (migration of hydrogen atoms, ring closure and oxidation) to form cubebol as a minor collateral product (4.42% according to enzymatic test 11). For its part, the cationic muurolenyl could undergo the migration of hydrogen 1,2, followed by the formation of a bond between C2-C7 (ring closure 2.7) to generate a transient macrocycle from which it would be formed by detonation in C3. Collateral product Acopaeno (9.65% [Table 5], and 19.60% [Table 6]). Alternatively, the cationic muurolenyl could be detoned to form a-muurolene as a minor collateral product (1.92% [Table 6]). In an additional mechanistic reaction, 3Z, 7E-germacradienyl cation could be transformed into germacrene O (11.8% [Table 5] and 9.36% [Table 6]), and bicyclogermacrene (4.05% [Table 5), and 3.56% (Table 6)) (route f in Fig. 9A). The biosynthesis of sesquiterpenes derived from eleman or Gauian by the CsTPS3 protein could occur through the transient formation of the germacrene intermediate A (Fig. 98). In this mechanistic scenario, the cylization of E, E-farnesyl cation between carbons 10 and 1 (route 9 in Fig. 98), would form the E, E-germacradienyl cation. The subsequent detonation of E, Egermacradienil cation would generate the neutral intermediate germacrene A. It could not leave the active site of the CsTPS3 enzyme, since its hydrophobic nature would not allow it to enter that cavity again. A similar mechanism has been suggested to explain the catalytic activity of the SasesquiTPS1 of the sandalwood tree (Santalum album) (Jones et al. (2008), Arch Biochem Biophys. 447: 121-130). The Tyr residues that occupy positions 520 (y520) and 527 (y527) in the amino acid sequence of the TEAS protein, and that have been involved in the formation of germacrene A, are conserved in the orange sesquiterpene synthase CsTPS3 (Fig . 5). Germacrene A has been postulated as an intermediate product in the reaction mechanism that results in the formation of 5epi-Aristolochene. The residue and 527 of TEAS seems to be involved in the protonation of germacrene A (Starks et al. (1997) Science 277, 1815-1820). The mutagenesis of the residue and 520 (y520 F) of TEAS, generates a modified TEAS that produces germacrene A and not 5-epiaristoloquene as the final product (Rising et al. (2000) J Am Chem Soco122, 186 1-1866). Therefore, the residue and 520 would prevent the exit of germacrene intermediate A from the catalytic cavity of the TEAS protein, while the residue and 527 would be involved in activation of germacrene A necessary for the formation of 5-epi-aristoloqueno. The formation of the a-bulneseno collateral product (1.69% [Table 6]) by the CsTPS3, would take place as a consequence of the formation of the cationic guianyl by the protonation of germacrene A and ring closure 6.2. The elemanos are considered products of degradation of the germacrenos due to Cope rearrangements (stereospecific reactions that proceed via states of transitions of chair conformations), induced by the high temperatures of the injector during GC-MS analysis (reviewed by Adio, [2009] Tetrahedron 65, 15331552). Thus, for example, the rearrangement Cope of germacrene A and germacrene B lead to the formation of J3-elemene and y-elemene, respectively. It has also been suggested that elemol is probably the product of thermal breakdown of hedicariol, since the essential oil rich in elemol from the Australian mulberry (Hedycarya angustifolia A. Cunn) mainly produces hedicariol and only traces of elemol when the oil is extracted at room temperature. EXAMPLE 5. Mutagenicity and biochemical characterization of the modified versions of the orange CsTPS3 polypeptide One of the most interesting characteristics of plant sesquiterpene synthase enzymes is their ability to form multiple products with different structure (skeleton of carbon atoms), even when they share a common three-dimensional (3D) structure. The catalytic activity and chemical diversity of its products lies largely in the differential folding of the FPP substrate inside the catalytic cavity (Starks et al. (1997) Science 277, 1815-1820; Bouwmeester et al., (2002 ] Planl Physiol 129, 134-144; Deligeorgopoulou and Alleman (2003] Biochemislry 42, 7741-7747) The spatial location of the side chains of some amino acids at the active site of the protein catalytically distinguishes one sesquiterpene synthase from the rest. It has also been suggested that the multiproduct character of vegetable sesquiterpenes synthases may also be a consequence of the presence of two independent compartments inside the active site of the enzyme, thus, the mutagenesis analysis of the corn multidripte terpene synthase ZmTPS4, demonstrated that the first stages in the FPP transformation pathway until the formation of the bisabolyl cation monocyclic intermediate are catalyzed in the compartment imento 1, while the secondary stages of cyclization until the formation of bicyclic sesquiterpenes takes place in compartment II (K6l1ner et al., [2006] Arch Biochem Biophys. 448: 83-92). The structural similarities of the different sesquiterpene synthases and their reaction products suggest that small changes in the geometry of the active center of the enzyme, due to the differences in identity and spatial location of the side chains of certain key amino acids, are sufficient to alter the specificity of their reaction mechanisms. The amino acid residues located in the layers surrounding the active site can also influence the conformation and product specificity of sesquiterpene synthases. In this sense, it has been shown that the 5 Biotechnology through the use of recombinant DNA techniques and genetic engineering constitutes a powerful strategy to manipulate the catalytic activity of sesquiterpene synthases, allowing to increase the yield and / or specificity of certain sesquiterpenes of interest. 10 Materials and Methods: The modified versions of the o-cadineno synthase (CsTPS3, SEO ID NO: 2) object of the invention, were generated in vitro by directed mutagenesis. For this purpose, specific mutations or combination of multiple point mutations were specifically introduced in the nucleotide sequence of the cDNA of the Cstps3 gene (SEO ID NO: 2). The modified cDNAs objects of the invention encode modified polypeptides 15 containing specific substitutions in their amino acid sequence, with respect to the natural sequence of the orange-o-cadineno synthase enzyme (CsTPS3, SEO ID NO: 4). To generate individual or multiple substitutions of base pairs, the QuickChange® II Site-direct and QuickChange® Multi Site-Direct Mutagenesis kits (Stratagene) commercial systems, respectively, were used. Both types of systems allowed the introduction of 20 specific mutations (point or multiple) in a single assay, in the cDNA nucleolide sequence encoding the natural polypeptide CsTPS3 (SEO ID NO: 2), which had previously been cloned into the expression vector pET45b (+). Both methods require the synthesis of modified oligonucleotides of 25-45 bases in length, which carry the mutation or mutations of interest and that will be used as primers in a single 25 PCR reaction. The substitution of the desired bases should be located in the center of the oligonucleotide and with a correct sequence on both sides of 10-15 nucleotides. The QuickChange software program (http: //www.stratagene.com/qcprimerdesign) was used to design the primers. according to the manufacturer's instructions. The primers used for the cDNA mutagenesis of the Cstps3 gene are shown in the Table 30 7. TABLE 7 Oligonucleotides used as primers for the mutagenesis of the Cstps3 gene cONA (SEO ID NO: 1) encoding the orange B-cadineno synthase (CsTPS3. SEO ID NO: 2). SEQIO Sequen ce oligonucleotide (5 '~ 3') NO 13 CsTPS3 S41 8HGATGTGGTTGACAACATTGGGTGGCCAGATGTAACT AATGCAAC 14 Cs TPS3 C45 'GATCCATGAGTCGGCCAACTATAGAAGAAGCCCTAAT AAATCT fifteen CsTPS3 S41 & r G417T S418Y-_Forv: ard 'GATGAGTACATGACGGTTGCATTAGTTACAACTACC TATCCAATGTTGTCAACCACATCC 16 CsTPS3 s41 'T G41 7T S41 8Y-Rev ~ rse'GGATGTGGTTGACAACATTGGATAGGTAGTTGTAAC TAATGCAACCGTCATGTACTCATC Results: Table 2 shows the simple and multiple amino acid substitutions that were introduced in the amino acid sequence of the natural polypeptide CsTPS3 (SEQIO NO: 2), as a consequence of the base pair substitutions introduced in the natural nueleotidic sequence of the CONA of the Cstps3 gene (SEO ID NO: 1) (Fig. lA). The nucleotide sequence of the mutated nucleic acid molecules object of the present invention, which encode modified variants of the orange O-cadineno synthase (CsTPS3, SEO ID NO: 2) correspond to the VB2 versions (SEO ID NO: 3; Fig. .1B), VB5 (SEO ID NO: 5; Fig. Le), VC1 (SEO ID NO: 7; Fig. 10) and VC2 (SEO ID NO: 9; Fig. LE). The cONA mutated molecules encode modified polypeptides that contain the S418H S416T non-conserved substitution or C "55G, or the substitution conserved in combination with the unconserved substitutions G417T and S418Y (Fig. 3). The high degree of similarity that has been found between hundreds of vegetable sesquiterpene synthases suggests that the catalytic activity of these Enzymes are a direct consequence of protein folding.Comparison of the sequence of vegetable sesquiterpene synthases has shown that their highly conserved motifs control cyclization reactions common to all of them, while variable regions contribute to differences in site folding The changes in the geometry of the active site can force different conformations of the FPP substrate and of the macrocyclic intermediates that control the selective catalysis and the rationalization of their different products.The identification of the amino acid residues involved in the reaction mechanisms of different TPS and generation With variants with altered catalytic properties, it has been possible thanks to the comparison and analysis of sequences in combination with in situ / ico modeling using the 3D structure of some sesquiterpene synthases as a template (Chang et al., [2005] Biolechnol Leff. 27, 285-288; Deligeorgopoulo and Alleman, [2003] Biochemislry 42,7741-7747; Kampranis et al., [2007] Planl Ce1 / 19, 1994-2005; Yoshikuni et al., [2006], Chem Biol. 13, 91-98). Alignment of the amino acid sequence of the natural orange CsTPS3 polypeptide with sesquiterpene without phylogenetically related rates 5 revealed some amino acid changes in its C-terminal region, in positions analogous to those residues that have been implicated in the formation of several bicyclic sesquiterpenes (Fig. 5). The silica modeling of the CsTPS3 polypeptide performed on the basis of homology with the crystallized structure of tobacco 5-epi-aristoloquene synthase (TEAS, PBO: 5EAT; Starks et al., [1997] Science 277, 1815-1820), demonstrated that the CsTPS3 enzyme has in effect the typical folding of sesquiterpene synthase enzymes (Fig. 10). Molecular modeling of orange O-cadineno synthase (CsTPS3) also revealed that most of the amino acids involved in the catalysis of the FPP substrate are highly conserved, and that they have a spatial arrangement almost identical to that corresponding to the TEAS model protein ( Fig. 11). However, the identity and spatial location of some amino acids that are in direct contact with the FPP substrate in the catalytic cavity of the CsTPS3, differ with respect to that observed in the TEAS model protein (Fig. 10). For example, the amino acids of the tetrad 4O'TTTy ', involved in the stabilization of the carbocationic intermediate via partial charges distributed locally in the catalytic cavity of TEAS (Starks et al., [1997] Science 20 277, 1815-1820), correspond to the sequence 41srSGS418 in the CsTPS3 polypeptide (Figs. 5 and 11). To analyze the impact of these wastes on the rationalization of sesquiterpenes (T402 (T403 produced by CsTPS3 cyclase, residues S '"in TEAS), G417 in TEAS), and S418 (r04 in TEAS) were modified by directed mutagenesis (Table 2). Mutagenesis of the selected amino acids (Table 2), so single or multiple, resulted in 25 enzymatically competent proteins but with an altered catalytic activity The introduced mutations caused incrementol and / or suppression of the performance of specific sesquiterpenes, compared with those produced by the natural enzyme of orange tree CsTPS3. contribution of residue C455 (located near the NSE / OTE motif; Fig. 5) to the product specificity of the natural polypeptide CsTPS3, 30 its nucleophilic side chain was replaced by the less reactive side chain of the amino acid Gly (G). Replacement C455G caused the conversion of the Ocadineno synthase activity of the natural polypeptide CsTPS3 (SEO ID NO: 2), into the elemol synthase activity exhibited by the polypeptide C modified CsTPS3-VB2 (Fig. 7S and 8S). The CsTPS3-VB2 polypeptide produced mostly elemol (77.49% [Table 5). 66.70% [Table 6)), 35 in addition to guaiol (22.51% [Table 5)), or a discrete amount bulnesol (15.48% [Table 6)) along with a small amount of & -cadinene ( 3.19% [Table 6]). Additionally, the 2S 3S C455G substitution caused a drastic reduction in the rationalization of all minor collateral products formed by the natural enzyme O-cadineno synthase (CsTPS3) (Fig. 7 and 8, Tables 5 and 6). It is likely that the C455G substitution has affected the isomerization of Z, E-germacradienyl cation (Fig. 9A), while favoring the closure of the E, E-farnesil cation between C10-C1 carbons. This cyclization stage would lead to the formation of hedicariol, the precursor of the mole (Fig. 9B). The multiple replacement of C455G and S418H in the Natural sequence of the CsTPS3 polypeptide (SEO ID NO: 2), had an additive effect on the production of the mole (Fig. 7C and BC). Likewise, the combination of mutations C455G and S418H also had a negative effect on the production of other minor collateral products (Fig. 7C and SC, Tables 5 and 6). Thus, the modified CsTPS3-VB5 polypeptide (SEO ID NO: 6), which carries the C455G and S418H substitutions, produced elemol in an almost exclusive manner (87.78% [Table 5], 83.86% [Table 6]) . The modified CsTPS3-VB5 polypeptide also produced a discrete amount of guaiol (12.22%, (Table 5)), ° bulnesol (11.4%, [Table 6)) together with a small amount of (; -cadinene (1 , 15% [Table 6)), and only traces of other collateral sesquiterpenes. The synergistic effect of the C455G and S418H mutations on the production of elemol was estimated between 13-29%, depending on the enzymatic method used (Tables 5 and 6). In the mechanistic scenario, it seems likely that the replacement of the hydroxyl group of the Ser at position 418 (S418) by the longer and more voluminous side chain of the His (S418H) stabilizes the E, E-germacradienyl cation at the bottom hydrophobic of the catalytic cavity of the modified polypeptide CsTPS3-VB5 (SEO ID NO: 6). The in si / ico modeling of the CsTPS3-VBS polypeptide performed on the structure of the TEAS protein showed that the side chains of the mutated amino acids alter the catalytic cavity geometry of the active site of the enzyme, compared to that corresponding to the natural polypeptide CsTPS3 (SEO ID NO: 2) (Fig. 12). In an attempt to transmute the o-cadineno synthase activity of the natural pOlipypeptide CsTPS3 (SEOI ID NO: 4), in a germacrene D synthase, the triad 416SGS418 was replaced by the sequence 416TTY'18 (Figs. 1 DY 3), since Most of these residues are well conserved in almost all germacrene D synthases phylogenetically related to orange tree CsTPS3, including the S-epi-ari stoloquene synthase model protein (Fig. 5 and 6). Indeed, replacing the triad 416SGS418 with 416TTy418 transformed the 0cadineno synthase activity of the CsTPS3 polypeptide (SEO ID NO: 2), into a highly efficient germacrene D synthase corresponding to the modified CsTPS3-VC1 polypeptide (SEO ID NO: 8) (Figs. 7D and 8D; Table 5 and 6). Thus, the CsTPS3-VC1 polypeptide produced almost exclusively germacrene D (77.61% [Table 5], 84.46% [Table 6]). The in silico modeling of the modified CsTPS2-VC1 polypeptide on the structure of the TEAS protein showed that the side chains of amino acids 416TTY '18 alter the geometry of the active site cavity, compared with that corresponding to that of the natural enzyme CsTP83 (Fig. 12). The replacement of the hydroxyl group of residue 8422 by the short aliphatic side chain of the Ala, whose position is conserved in all germacrene D enzymes without phylogenetically related rates (Fig. 5), had little effect on the activity of the polypeptide variant CsTPS-VC2 (SEO ID NO: 10), since this mutation did not alter the production of germacrene O (Fig. 7E YSE, Tables 5 and 6).
权利要求:
Claims (18) [1] one. A polypeptide characterized in that it has sesquiterpene synthase activity and its sequence comprises at least 90% identity with SEO ID NO: 14. [2] 2. A polypeptide according to claim 1, wherein the sesquiterpene synthase activity is at least one selected from the group consisting of: o-cadineno synthase activity, elemol synthase activity and germacrene O synthase activity. 3. A polypeptide according to any one of claims 1 or 2, wherein its sequence comprises at least 90% identity with SEO ID NO: 2, or with SEO ID NO: 2 modified with at least one substitution in an amino acid that alters sesquiterpene synthase activity and / or product specificity, and where said substitution is selected from at least one of the group consisting of: 15 a. a substitution of the cysteine at position 455 with glycine (C455G), and b. a triple substitution of the serine at position 416 by threonine, of the glycine in position 417 for threonine, and serine for position 418 for tyrosine (S416T / G417T IS418y). A polypeptide according to claim 3, wherein the modified SEO ID NO: 2 further comprises another substitution in an amino acid of its sequence, and that: to. when SEO ID NO: 2 comprises the C455G substitution, it is a substitution of the serine at position 418 with histidine (S418H), and b. when SEO ID NO: 2 comprises the triple substitution S41 & r / G417T / S418y, it is a serine substitution at position 422 with alanine (S422A). [5] 5. A polypeptide according to any one of claims 1 to 4 comprising a sequence selected from the group consisting of: SEO ID NO: 2, SEO ID NO: 16 and SEO ID NO: 18. [6] 6. A polypeptide according to claim 5, wherein: to. when its sequence includes SEO ID NO: 2, it presents o-cadineno synthase activity, b. when its sequence includes SEO ID NO: 16, it presents activity of the synthase, or 35 c. when its sequence comprises SEQ ID NO: 18, it has germacrene D synthase activity. [7] 7. A polypeptide according to any one of claims 1 to 5, which is a sesquiterpene synthase selected from the group consisting of: the o-cadineno synthase CsTPS3 consisting of SEO ID NO: 2, the elemol synthase CsTPS3-VB2 consisting of SEO ID NO: 4, the elemol synthase CsTPS3-VB5 consisting of SEO ID NO: 6, the germacrene D 5 synthase CsTPS3-VC1 consisting of SEO ID NO: 8 and germacrene D synthase CsTPS3-VC2which consists of SEO ID NO: 10. [8] 8. A nucleic acid characterized in that it comprises a sequence encoding a polypeptide defined in any one of claims 1 to 7. [9] 9. A nucleic acid according to claim 8, which when encoding a polypeptide comprising SEO ID NO: 2, consists of a polynucleotide comprising SEO ID NO: 1. [10] 10. A nucleic acid according to claim 8 which, when encoding a polypeptide that 15 comprises the modified SEO ID NO: 2 sequence, consists of a polynucleotide comprising the SEO ID NO: 1 sequence with at least one mutation selected from the group consisting of: to. a T-G transversion at position +1363 with respect to the start codon (ATG) of SEO ID NO: 1: and 20 b. a group of nucleotide substitutions T_NG_NAGC_TAT at positions + 1246/1249 / 1252-1254 with respect to the start codon (ATG) of SEO ID NO: 1. [11] 11. A nucleic acid according to claim 10 consisting of a polynucleotide in the which, in addition to the mutation in the SEO ID NO: 1, 25 sequence polynucleotide further comprises another mutation in SEO ID NO: 1 that is selected from: to. an AG-CA transverse / transition at positions +1252/1253 with respect to the start codon, when SEO ID NO: 1 comprises the T-G transversion; Y b. a T _A transversion at position + 1264 with respect to the SEO start codon ID NO: 1, when SEO ID NO: 1 comprises the substitution group 30 T_NG_NAGC_TAT. [12] 12. A nucleic acid according to claim 8 comprising a polynucleotide sequence selected from the group consisting of: SEO ID NO: 1, SEO ID NO: 3, SEO ID NO: 5, SEO ID NO : and SEO ID NO: 9. [13] 13. A gene construct characterized in that it comprises at least one nucleic acid defined in any one of claims 8 to 12. [14] 14. An expression vector characterized in that it comprises a gene construct5 defined in claim 13. [15] 15. A bacterial strain characterized in that it comprises an expression vector defined in claim 14. A method for obtaining a polypeptide with sesquiterpene activity without rate, characterized in that it comprises culturing a bacterial cell transformed with a nucleic acid defined in any one of claims 8 to 12, or with a recombinant vector comprising it, under suitable conditions to favor or induce the expression of said nucleic acid. [17] 17. Use of at least one polypeptide defined in any one of claims 1 to 7 for the sesquiterpene synthesis. [18] 18. Use according to claim 17 characterized in that said synthesis is carried out in vitro. [19] 19. Use according to any one of claims 17 or 18 characterized in that the synthesized sesquiterpene is at least one selected from the group consisting of: a-cubebeno, a-copaeno, ¡3-cubebeno, ¡3-elemeno, a-gu ~ uneno, E-¡3-cariofileno, a-humuleno, germacreno D, bicidogermacreno, a-muuroleno, a-bulneseno, cubebol, i5-cadineno, elemol, germacreno 0-4-01, 25 bulnesol and guaiol, or a combination of any two or more of the above. [20] 20. Use according to any one of claims 17 to 19 characterized in that the synthesized sesquiterpene is at least one selected from the group consisting of: & -cadinene, elemol and germacrene D, or a combination of any two or more of the foregoing. [21] 21. A method for synthesizing at least one sesquiterpene characterized in that it comprises: to. incubate the farnesyl pyrophosphate substrate with at least one polypeptide defined in a any one of claims 1 to 6, 35 b. allow to react until a volatile product comprising sesquiterpene is obtained.
类似技术:
公开号 | 公开日 | 专利标题 Yahyaa et al.2015|Identification and characterization of terpene synthases potentially involved in the formation of volatile terpenes in carrot | roots Mercke et al.2000|Molecular cloning, expression, and characterization of amorpha-4, 11-diene synthase, a key enzyme of artemisinin biosynthesis in Artemisia annua L. Hsiao et al.2008|A novel homodimeric geranyl diphosphate synthase from the orchid Phalaenopsis bellina lacking a DD | 2–4D motif Jia et al.1999|-Linalool synthase from Artemisia annua L.: cDNA isolation, characterization, and wound induction EP2311940B1|2017-08-09|Novel sesquiterpene synthases and methods of their use CN101163795B|2014-04-23|Transformed plants accumulating terpenes Pazouki et al.2015|Germacrene A synthase in yarrow | is an enzyme with mixed substrate specificity: gene cloning, functional characterization and expression analysis ES2379461T3|2012-04-26|Terpene synthase / cyclase and olefin synthase and their uses Fujisawa et al.2010|Cloning and characterization of a novel gene that encodes |-β-bisabolene synthase from ginger, Zingiber officinale Yahyaa et al.2013|Formation of norisoprenoid flavor compounds in carrot | roots: characterization of a cyclic-specific carotenoid cleavage dioxygenase 1 gene Abbas et al.2019|Functional characterization and expression analysis of two terpene synthases involved in floral scent formation in Lilium ‘Siberia’ Pateraki et al.2008|Isolation and functional analysis of two Cistus creticus cDNAs encoding geranylgeranyl diphosphate synthase CN107630025B|2020-04-14|Lily terpene flower fragrance gene LoTPS3 and application thereof Fähnrich et al.2011|Product variability of the ‘cineole cassette’monoterpene synthases of related Nicotiana species BR112012009803A2|2020-07-28|methods to control huanglongbing disease | from citrus plants Benabdelkader et al.2015|Functional characterization of terpene synthases and chemotypic variation in three lavender species of section Stoechas AU747075B2|2002-05-09|Sesquiterpene synthases from grand fir abies grandis, and methods of use JP5219025B2|2013-06-26|Nucleic acid encoding a polypeptide having sesquiterpene synthase activity Fähnrich et al.2012|Synthesis of ‘cineole cassette’monoterpenes in Nicotiana section Alatae: gene isolation, expression, functional characterization and phylogenetic analysis ES2540791A1|2015-07-13|New sesquiterpene synthases isolated from orange peel. | JP2003144183A|2003-05-20|Isopentenyl-2-phosphoric acid isomerase separated from hevea brasilienses and method for producing rubber using the same Fähnrich et al.2014|Characteristic alatoid ‘cineole cassette’monoterpene synthase present in Nicotiana noctiflora WO2007029854A1|2007-03-15|Inhibitor for lachrymatory factor synthase ES2792041T3|2020-11-06|Sesquiterpene production procedure CN109825482B|2021-06-22|Herbicide-resistant gene and application thereof in plant breeding
同族专利:
公开号 | 公开日 WO2015086885A1|2015-06-18| ES2540791B1|2016-05-09|
引用文献:
公开号 | 申请日 | 公开日 | 申请人 | 专利标题 JP4571862B2|2002-10-04|2010-10-27|フイルメニツヒソシエテアノニム|Sesquiterpene synthesis and methods of use| JP2007517496A|2003-09-02|2007-07-05|ステートオブイスラエル、ミニストリーオブアグリカルチャー、アグリカルチュラルリサーチオーガナイゼイション|Citrus sesquiterpene synthase, method for its production, and method of use|US11124807B2|2017-05-03|2021-09-21|Firmenich Sa|Sesquiterpene synthases for production of drimenol and mixtures thereof|
法律状态:
2016-05-09| FG2A| Definitive protection|Ref document number: 2540791 Country of ref document: ES Kind code of ref document: B1 Effective date: 20160509 | 2016-10-24| FA2A| Application withdrawn|Effective date: 20161018 |
优先权:
[返回顶部]
申请号 | 申请日 | 专利标题 ES201331820A|ES2540791B1|2013-12-13|2013-12-13|New sesquiterpene synthases isolated from orange peel.|ES201331820A| ES2540791B1|2013-12-13|2013-12-13|New sesquiterpene synthases isolated from orange peel.| PCT/ES2014/070916| WO2015086885A1|2013-12-13|2014-12-12|New sesquiterpene synthases isolated from orange peel| 相关专利
Sulfonates, polymers, resist compositions and patterning process
Washing machine
Washing machine
Device for fixture finishing and tension adjusting of membrane
Structure for Equipping Band in a Plane Cathode Ray Tube
Process for preparation of 7 alpha-carboxyl 9, 11-epoxy steroids and intermediates useful therein an
国家/地区
|